ID: 1178303345

View in Genome Browser
Species Human (GRCh38)
Location 21:31470773-31470795
Sequence AGACAGTGGCTGTTTCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303345_1178303352 2 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303352 21:31470798-31470820 CCAGGAGAAGAGAGAGGAACCGG No data
1178303345_1178303348 -4 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303348 21:31470792-31470814 GTCTCCCCAGGAGAAGAGAGAGG No data
1178303345_1178303358 21 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303358 21:31470817-31470839 CCGGCAGGTGGTGGGTACCCAGG No data
1178303345_1178303356 13 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data
1178303345_1178303354 9 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303354 21:31470805-31470827 AAGAGAGAGGAACCGGCAGGTGG No data
1178303345_1178303353 6 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303353 21:31470802-31470824 GAGAAGAGAGAGGAACCGGCAGG No data
1178303345_1178303355 12 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303355 21:31470808-31470830 AGAGAGGAACCGGCAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303345 Original CRISPR AGACAGTGGCTGTTTCTACA TGG (reversed) Intronic