ID: 1178303347

View in Genome Browser
Species Human (GRCh38)
Location 21:31470787-31470809
Sequence CTCTTCTCCTGGGGAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303347_1178303360 24 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data
1178303347_1178303353 -8 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303353 21:31470802-31470824 GAGAAGAGAGAGGAACCGGCAGG No data
1178303347_1178303356 -1 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data
1178303347_1178303358 7 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303358 21:31470817-31470839 CCGGCAGGTGGTGGGTACCCAGG No data
1178303347_1178303355 -2 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303355 21:31470808-31470830 AGAGAGGAACCGGCAGGTGGTGG No data
1178303347_1178303354 -5 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303354 21:31470805-31470827 AAGAGAGAGGAACCGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303347 Original CRISPR CTCTTCTCCTGGGGAGACAG TGG (reversed) Intronic