ID: 1178303349

View in Genome Browser
Species Human (GRCh38)
Location 21:31470796-31470818
Sequence GGTTCCTCTCTCTTCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303349_1178303356 -10 Left 1178303349 21:31470796-31470818 CCCCAGGAGAAGAGAGAGGAACC No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data
1178303349_1178303358 -2 Left 1178303349 21:31470796-31470818 CCCCAGGAGAAGAGAGAGGAACC No data
Right 1178303358 21:31470817-31470839 CCGGCAGGTGGTGGGTACCCAGG No data
1178303349_1178303360 15 Left 1178303349 21:31470796-31470818 CCCCAGGAGAAGAGAGAGGAACC No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303349 Original CRISPR GGTTCCTCTCTCTTCTCCTG GGG (reversed) Intronic