ID: 1178303351

View in Genome Browser
Species Human (GRCh38)
Location 21:31470798-31470820
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303351_1178303358 -4 Left 1178303351 21:31470798-31470820 CCAGGAGAAGAGAGAGGAACCGG No data
Right 1178303358 21:31470817-31470839 CCGGCAGGTGGTGGGTACCCAGG No data
1178303351_1178303360 13 Left 1178303351 21:31470798-31470820 CCAGGAGAAGAGAGAGGAACCGG No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303351 Original CRISPR CCGGTTCCTCTCTCTTCTCC TGG (reversed) Intronic