ID: 1178303354

View in Genome Browser
Species Human (GRCh38)
Location 21:31470805-31470827
Sequence AAGAGAGAGGAACCGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303345_1178303354 9 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303354 21:31470805-31470827 AAGAGAGAGGAACCGGCAGGTGG No data
1178303347_1178303354 -5 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303354 21:31470805-31470827 AAGAGAGAGGAACCGGCAGGTGG No data
1178303344_1178303354 18 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303354 21:31470805-31470827 AAGAGAGAGGAACCGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303354 Original CRISPR AAGAGAGAGGAACCGGCAGG TGG Intronic