ID: 1178303355

View in Genome Browser
Species Human (GRCh38)
Location 21:31470808-31470830
Sequence AGAGAGGAACCGGCAGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303344_1178303355 21 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303355 21:31470808-31470830 AGAGAGGAACCGGCAGGTGGTGG No data
1178303347_1178303355 -2 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303355 21:31470808-31470830 AGAGAGGAACCGGCAGGTGGTGG No data
1178303345_1178303355 12 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303355 21:31470808-31470830 AGAGAGGAACCGGCAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303355 Original CRISPR AGAGAGGAACCGGCAGGTGG TGG Intronic