ID: 1178303356

View in Genome Browser
Species Human (GRCh38)
Location 21:31470809-31470831
Sequence GAGAGGAACCGGCAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303347_1178303356 -1 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data
1178303349_1178303356 -10 Left 1178303349 21:31470796-31470818 CCCCAGGAGAAGAGAGAGGAACC No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data
1178303344_1178303356 22 Left 1178303344 21:31470764-31470786 CCGGGAAAACCATGTAGAAACAG No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data
1178303345_1178303356 13 Left 1178303345 21:31470773-31470795 CCATGTAGAAACAGCCACTGTCT No data
Right 1178303356 21:31470809-31470831 GAGAGGAACCGGCAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303356 Original CRISPR GAGAGGAACCGGCAGGTGGT GGG Intronic