ID: 1178303360

View in Genome Browser
Species Human (GRCh38)
Location 21:31470834-31470856
Sequence CCCAGGTCAGCTCCATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178303347_1178303360 24 Left 1178303347 21:31470787-31470809 CCACTGTCTCCCCAGGAGAAGAG No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data
1178303357_1178303360 -6 Left 1178303357 21:31470817-31470839 CCGGCAGGTGGTGGGTACCCAGG No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data
1178303351_1178303360 13 Left 1178303351 21:31470798-31470820 CCAGGAGAAGAGAGAGGAACCGG No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data
1178303350_1178303360 14 Left 1178303350 21:31470797-31470819 CCCAGGAGAAGAGAGAGGAACCG No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data
1178303349_1178303360 15 Left 1178303349 21:31470796-31470818 CCCCAGGAGAAGAGAGAGGAACC No data
Right 1178303360 21:31470834-31470856 CCCAGGTCAGCTCCATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178303360 Original CRISPR CCCAGGTCAGCTCCATGAGC AGG Intronic