ID: 1178304306

View in Genome Browser
Species Human (GRCh38)
Location 21:31478283-31478305
Sequence CTATTTTAAGAGGACTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178304306_1178304308 1 Left 1178304306 21:31478283-31478305 CCAGATGAGTCCTCTTAAAATAG 0: 1
1: 0
2: 1
3: 13
4: 128
Right 1178304308 21:31478307-31478329 ACCAAGCTTTCTGTTTAGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178304306 Original CRISPR CTATTTTAAGAGGACTCATC TGG (reversed) Intronic
901663286 1:10812484-10812506 CAATTTACAGAGCACTCATCTGG + Intergenic
903714688 1:25356136-25356158 ATATTTTAAGAGGATCCCTCTGG - Intronic
906832561 1:49048545-49048567 CTATTTGAGGAGGGCTCAGCAGG + Intronic
907533453 1:55125980-55126002 CTATTTTCAAAAGACCCATCAGG + Intronic
907577797 1:55543711-55543733 CTGGTCTCAGAGGACTCATCAGG + Intergenic
910074321 1:83259565-83259587 CCTTTGTAAGAGAACTCATCAGG - Intergenic
912004030 1:104873281-104873303 CAATTTTGAGAGTACTGATCAGG - Intergenic
913568809 1:120100254-120100276 CAATTTTTAGAGGAATGATCGGG - Intergenic
914289627 1:146261275-146261297 CAATTTTTAGAGGAATGATCGGG - Intergenic
914550663 1:148712028-148712050 CAATTTTTAGAGGAATGATCGGG - Intergenic
916526642 1:165616742-165616764 CTATTTTAGAAGGACTGATCAGG + Intergenic
916849494 1:168689099-168689121 TTATTTTCAGACAACTCATCTGG + Intergenic
918754986 1:188328885-188328907 CTTATTTAAGTGGACCCATCTGG - Intergenic
919197822 1:194311592-194311614 CAATTTTAGGATGATTCATCCGG - Intergenic
919900227 1:202038763-202038785 CTATTTAAAGAGAAAACATCAGG - Intergenic
922148327 1:222972409-222972431 CTATTTTCGGAGGACTGATTTGG - Intronic
922984157 1:229852894-229852916 CTACTTTATGAGGACTAATTTGG - Intergenic
923797791 1:237175313-237175335 CTATTTTAAGATGCCTCATAAGG - Intronic
924695464 1:246395471-246395493 CTATTTTAAGAGAACCCGTGAGG - Intronic
924879277 1:248141204-248141226 CTTTTGTAAGAGGAATGATCAGG - Intergenic
1068993657 10:63178239-63178261 CTTTTTTAAGAGTACTGATCTGG - Intronic
1072113146 10:92342643-92342665 CTATTTTAAGAGGATTCATTTGG - Intronic
1074607748 10:114990835-114990857 TTATTTTAAGAAGATTAATCTGG + Intergenic
1075267990 10:121021867-121021889 CTATTTTAAGATGATTCTTTCGG + Intergenic
1094084133 12:26570710-26570732 CTTTTTTAAGAGGAATAATATGG + Intronic
1095376683 12:41537658-41537680 TTATATTAAGAAGATTCATCAGG + Intronic
1097536009 12:60871947-60871969 ATATTTTAAAAGGACTTATTGGG + Intergenic
1097711530 12:62922851-62922873 CTATTGAAAGAGTACTCTTCAGG + Intronic
1098055594 12:66502114-66502136 ATATTTTAAGAGAATTTATCAGG + Intronic
1098401032 12:70075910-70075932 CTTTTTTATGAGGACTTCTCTGG + Intergenic
1100913855 12:99395231-99395253 CTATTTTATGAGGATTAATCTGG - Intronic
1101654241 12:106706005-106706027 GTCTTTCAAGAGGAATCATCAGG + Intronic
1103258344 12:119562811-119562833 CTGTTTTAAGAGTATTCCTCTGG - Intergenic
1105574422 13:21636916-21636938 GTATTTTAAAAGAAATCATCTGG + Intergenic
1107362994 13:39639863-39639885 CTATTTTTAGAGGACTGATTTGG + Intergenic
1107439122 13:40408745-40408767 TTATTTTAACATGACTCATTAGG + Intergenic
1107732323 13:43360665-43360687 CTTTTTTAAGTGGACTTTTCAGG - Intronic
1108834245 13:54521010-54521032 CTATTTAAAGTGTAATCATCAGG - Intergenic
1110870539 13:80447891-80447913 CTACTATAAGAGGAGTCAGCTGG + Intergenic
1114817381 14:25976454-25976476 CTATTTTAAATGGACTCTTTTGG - Intergenic
1115208717 14:30942654-30942676 CTACTTTATAAGGACTCATTGGG - Intronic
1115949545 14:38704766-38704788 CCAATTCAAGAGGCCTCATCTGG + Intergenic
1116418028 14:44701665-44701687 CTAGTCTAAGATGACTCAGCAGG + Intergenic
1117102892 14:52368700-52368722 CTTCCTTAAGAGGACTCACCTGG - Intergenic
1119566744 14:75635562-75635584 CTATTTTAAAAGGTTTTATCAGG + Intronic
1120382140 14:83793941-83793963 CTATTTTAAGTGTAATCATAAGG - Intergenic
1121326547 14:93023516-93023538 CTATTTTATGAGGACAGATTTGG - Intronic
1124174347 15:27408255-27408277 GTATTTTAAGAGGACTGCCCTGG + Intronic
1127235462 15:57046020-57046042 CTATTGTTAGAGAACTCATTTGG - Intronic
1128298536 15:66546449-66546471 CTACTTTAAGAGAATTCATTGGG - Intronic
1136521946 16:30802508-30802530 CTTTTTCAAGAGGACTCTACAGG - Intergenic
1136661666 16:31768428-31768450 CAATTCTAAGAGAACTCATCAGG - Intronic
1143719983 17:8802684-8802706 ATATGTTAATAGGAATCATCAGG - Intergenic
1150008094 17:61482066-61482088 CCAATTTAAGAACACTCATCCGG - Intronic
1151079629 17:71314017-71314039 CTATTTTATGAGGATTTAACTGG - Intergenic
1151253500 17:72856370-72856392 TTATTTAAAGAGGCCTCATTTGG - Intronic
1153516861 18:5911832-5911854 TTATATTAAGAGGAATCTTCTGG + Intergenic
1154501488 18:14999942-14999964 CTCTTTTAAGATGACCCATACGG - Intergenic
1159128762 18:64256042-64256064 CTGGTTTAAGAGGACTGATCTGG + Intergenic
1159671233 18:71223147-71223169 ATATTTTAACAGGACTTTTCTGG - Intergenic
930284171 2:49407343-49407365 CTATTTTAAATGGGTTCATCAGG - Intergenic
932145123 2:69309344-69309366 GTATTGTGAGAGGACTCCTCTGG - Intergenic
933805001 2:85992283-85992305 ACTTTTTAAGATGACTCATCAGG + Intergenic
935272760 2:101449310-101449332 GAATTTTAGGAGGATTCATCTGG + Intronic
935659593 2:105454733-105454755 CAATTTTAAGAAGACTCAGTGGG - Intergenic
935828762 2:106977398-106977420 CCATTTTAAGAGGATGCCTCAGG + Intergenic
938906640 2:135842955-135842977 ATATTTTAAAAAGACTTATCTGG + Intronic
942903173 2:181147211-181147233 TTATTTAAAGAGAAATCATCAGG + Intergenic
944379832 2:199095486-199095508 CTATTTAAAGAGAAGTCATGTGG + Intergenic
947141621 2:227024208-227024230 ATATTTTAAAAGGTATCATCTGG + Intronic
948882352 2:240866326-240866348 CAGTTTTAAGAGGACTCATATGG - Intergenic
1168957991 20:1848211-1848233 CTGTTTTAACAGGATTCCTCTGG + Intergenic
1173341031 20:42153277-42153299 CTATTTTATGAACACTAATCTGG - Intronic
1173429007 20:42968891-42968913 CTAGTTGTAGAGGACCCATCAGG + Intronic
1174890460 20:54386226-54386248 CTCTTTCAAGAGGGCGCATCGGG + Intergenic
1178304306 21:31478283-31478305 CTATTTTAAGAGGACTCATCTGG - Intronic
1178566573 21:33691917-33691939 GTATTTTGAGAGGACACATTTGG + Intronic
1181257493 22:21573320-21573342 CTGTTTTTAGGGGACTCAACGGG - Intronic
1184670377 22:46009172-46009194 CTGTTTTAGGAAGACTCCTCTGG - Intergenic
950564655 3:13761310-13761332 CCATCTTCAGAGGGCTCATCAGG - Intergenic
951634732 3:24760857-24760879 CTATTTGAGCAGGATTCATCAGG + Intergenic
952135565 3:30415264-30415286 CTATTTGAAGAGGAATAATGAGG + Intergenic
954856325 3:53647041-53647063 CTGTTTAAAGAAGACACATCAGG + Intronic
956745733 3:72309743-72309765 TTATTTTAAGAGACCTCAGCTGG - Intergenic
956778800 3:72588302-72588324 TTTTTTTAAGAAGACTCTTCTGG - Intergenic
962505053 3:136038406-136038428 CCATTTTAATAGGAGTCTTCTGG + Intronic
962915781 3:139902214-139902236 ACATTTTAAGAGGAATCCTCTGG - Intergenic
964209808 3:154214287-154214309 TTATTTTTGGAGGACTCATAAGG + Intronic
964518062 3:157534088-157534110 ATATTTTAAGAAGACTAATCTGG - Intergenic
964932405 3:162042866-162042888 ATATTTTAAAAGGAATCAACAGG - Intergenic
967326653 3:188247283-188247305 CTATTTTTAGAGCCTTCATCTGG + Intronic
972752039 4:41999047-41999069 CAATTTTAAGAGGCCTCTACTGG + Intronic
973823844 4:54685594-54685616 ATGTTTTAGGAGGACTCCTCTGG - Intronic
976919150 4:90415538-90415560 CTCATTTCAGAGGATTCATCAGG - Intronic
979340752 4:119520770-119520792 TTAATTAAAGAGGACTAATCTGG - Intronic
980835979 4:138193347-138193369 CTAGTAAGAGAGGACTCATCTGG - Intronic
986364088 5:7012109-7012131 CTATATTAAGAGGGCTGATATGG - Intergenic
988413472 5:30916017-30916039 CTCTTATAAGAGGAGACATCGGG - Intergenic
988597887 5:32611774-32611796 CTGTTTTTAGAGGCCTCATAGGG - Intergenic
989146227 5:38252712-38252734 CTATTTTAAGAGGGACCACCTGG + Intergenic
990624247 5:57593785-57593807 CAGTTTTAAGAGGACTCCACAGG - Intergenic
993975173 5:94470984-94471006 ATATTTGAAGAGGAAGCATCTGG - Intronic
994614832 5:102091181-102091203 CTATTGTAATGGGACTTATCTGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
998511061 5:142714295-142714317 GTATTTTAACAGGACTCTTTAGG + Intergenic
998649555 5:144102785-144102807 CTATTATAAGAGGCCTCGTTAGG + Intergenic
1001788288 5:174432634-174432656 CCAATGTAAGAGAACTCATCCGG + Intergenic
1001955761 5:175847201-175847223 GTATTTTAAGAAGATTCTTCTGG + Intronic
1002837246 6:875210-875232 CTGTTGTAAGATGAGTCATCAGG - Intergenic
1004580092 6:16941830-16941852 CTATTTTATGTGGACTTTTCTGG + Intergenic
1008064874 6:47036773-47036795 CTATTTCTAGAAGAATCATCTGG - Intronic
1011414591 6:87104608-87104630 ATATTTTCAGAAGACTCATCTGG - Intergenic
1013884805 6:114949237-114949259 TTATTTTAAGAGGCATCATTGGG + Intergenic
1014667789 6:124260707-124260729 ATATTTTAAGAGGATTACTCTGG + Intronic
1014715442 6:124859789-124859811 ATATTTTAAGTGGATTCTTCTGG - Intergenic
1017301670 6:152868301-152868323 TTTTTTTAGGAGGATTCATCTGG + Intergenic
1020526218 7:9262150-9262172 CTTATTTAAGAGGACTTTTCTGG - Intergenic
1021910678 7:25383243-25383265 CTATTTTGAGAGGGGTCATCTGG + Intergenic
1027292019 7:76724427-76724449 CCTTTGTAAGAGAACTCATCAGG - Intergenic
1027589356 7:80098413-80098435 ACATTTTAAGAGGGTTCATCAGG - Intergenic
1030138202 7:106279721-106279743 CTATTTTCAAAGGACTAATAAGG + Intronic
1031626437 7:123997786-123997808 CTATTTAAAGAGTAAACATCAGG - Intergenic
1033324231 7:140363954-140363976 TTACTTTAAAAAGACTCATCTGG + Intronic
1033355864 7:140599892-140599914 ATATTTTTAGAAGACTCCTCTGG + Intronic
1034755443 7:153613788-153613810 ATACTTTAAAAGGACTTATCAGG + Intergenic
1035007654 7:155679530-155679552 TTATTTTATGAGGAAACATCGGG + Intronic
1035544521 8:469284-469306 CTATTCAAAGAGGACTCATTTGG - Exonic
1035939259 8:3877432-3877454 CTAGATTAAGAGAATTCATCTGG - Intronic
1036090861 8:5663850-5663872 TTTTGTTTAGAGGACTCATCAGG + Intergenic
1038015887 8:23514434-23514456 CTGTGGGAAGAGGACTCATCTGG - Intergenic
1039405535 8:37309299-37309321 CTATTTTCAGAGGACATATCAGG + Intergenic
1040879333 8:52188599-52188621 GTATTTTAGGAGGACTATTCTGG + Intronic
1046573705 8:115998776-115998798 CTTTTTTCAGAGGAGACATCAGG + Intergenic
1048586450 8:135778470-135778492 CTACGTTAAAAGGACTCCTCTGG + Intergenic
1048614308 8:136057640-136057662 CTCATTTAAGAGGACTCTTACGG - Intergenic
1186589919 X:10919075-10919097 CCATTACAAGAGGACTCAGCTGG + Intergenic
1187546897 X:20264327-20264349 GTATTATAAGAGGTCTCATTTGG - Intronic
1189070939 X:37863390-37863412 CTACTTTAAAAGTCCTCATCTGG - Intronic
1189644800 X:43116455-43116477 CTATTTTAGAAGGACTGAACAGG + Intergenic
1191880668 X:65841419-65841441 ATAATTTAAAAGGACCCATCTGG - Intergenic
1192316014 X:70052479-70052501 CAATTTTAAAAGGAGTGATCAGG + Intergenic
1194039318 X:88920088-88920110 CTGCTTTTAAAGGACTCATCTGG - Intergenic
1197287532 X:124613804-124613826 CTATTTTAAATGGCATCATCTGG + Intronic