ID: 1178307800

View in Genome Browser
Species Human (GRCh38)
Location 21:31504914-31504936
Sequence ATTTCTGTCTTGCAGTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178307800 Original CRISPR ATTTCTGTCTTGCAGTATCA GGG (reversed) Intronic
904096190 1:27979428-27979450 ATTTCAGTGATGCAGTATCTTGG - Intronic
904126632 1:28244916-28244938 CTTTCTGTCTTGCATTGTCCTGG - Intronic
906097433 1:43233880-43233902 ATTTCTCTCTTGCAGATTCCTGG - Intronic
906403808 1:45525424-45525446 CTTTCTTTCTTGCAGGAGCAAGG + Intergenic
906874029 1:49516152-49516174 ATTTCTGTATCCCAGCATCAGGG - Intronic
907075539 1:51574899-51574921 ATCTCTTTCTTGTAGTTTCAAGG + Intergenic
907152751 1:52304885-52304907 AATCCTGCCTTGGAGTATCAAGG + Intronic
908060688 1:60345158-60345180 ATTTTTCTCTTTCAGTAACATGG + Intergenic
908439465 1:64139082-64139104 ACTTCTGCCTTCCAGTTTCAAGG - Intronic
909129167 1:71713729-71713751 AATGCTGTCTTGCATTGTCAAGG - Intronic
909998568 1:82313021-82313043 TTTTCTTTCTTGCATTATTATGG + Intergenic
910165727 1:84325622-84325644 ATTTGTGTTTTGCAGTTCCATGG + Exonic
911726505 1:101246678-101246700 AATTTTGTCTTGCCATATCAAGG - Intergenic
912685648 1:111760916-111760938 AGTTTTGTCTTGCTGTTTCATGG + Intronic
914239476 1:145843309-145843331 AATTCTCTCTCTCAGTATCACGG + Intergenic
915140300 1:153763817-153763839 ATTTCTGTCCTGCAGTGATACGG + Exonic
916004355 1:160646085-160646107 CTTTCTGTTTAGAAGTATCAGGG - Intronic
919765650 1:201125645-201125667 ATTTGTGTCTTGCTCTTTCAAGG + Intronic
919766564 1:201131337-201131359 TATTCTGTTTTGCAGTTTCATGG - Intergenic
919850960 1:201672155-201672177 ATTTCTGACTTGGAGGATCAAGG - Intronic
919893244 1:201991467-201991489 ATTTTCCTCTTGCAGTAACAGGG - Intronic
921420260 1:214939019-214939041 ATTTCTTTCTTGCAGGACCCTGG + Intergenic
922956270 1:229603705-229603727 TTCTCTGTCTTACAGTTTCATGG - Intronic
924174190 1:241373097-241373119 ATTTCTCTAATGCATTATCAAGG + Intergenic
924271477 1:242337712-242337734 ATTTCTGTCTCACAGCAGCATGG + Intronic
924294127 1:242568323-242568345 ATTTCTCTCTTGGGGTATGATGG - Intergenic
1062925336 10:1312125-1312147 CTTTCTGGCTTGCAGTGTCCTGG + Intronic
1063868250 10:10390178-10390200 ATTTCTATGTTGCAGTATTGAGG + Intergenic
1064815049 10:19251535-19251557 TTTCCTGTCTTTCTGTATCAGGG + Intronic
1065284244 10:24172208-24172230 TTTTCTGTCTTGCCCCATCATGG + Intronic
1065653175 10:27915826-27915848 GTTTCTTTCTGGCAATATCATGG - Intronic
1066713191 10:38258416-38258438 ATTTCTGTCTCACAGCAGCATGG - Intergenic
1067514932 10:46931137-46931159 ATTTCTGTCTGGCATTAACCAGG - Intronic
1067647322 10:48120677-48120699 ATTTCTGTCTGGCATTAACCAGG + Intergenic
1069305923 10:66969641-66969663 ATTTCTAGTTTGAAGTATCATGG - Intronic
1069541403 10:69296854-69296876 TTTTCTGTCTGGCAGTAGCAAGG + Intronic
1070354896 10:75630445-75630467 ATGTCTGTCTTGCAGTTTCTAGG + Intronic
1071009763 10:80924374-80924396 GTTTCTGTCTCGCAGTAGCAAGG - Intergenic
1072802237 10:98400250-98400272 ATTTGTGTTTTGCAGAAACATGG - Exonic
1073283080 10:102368974-102368996 ATTTCTGTCTTGCACACTCTGGG + Intronic
1074675379 10:115843170-115843192 ATATCTGCCTTGCAGAAGCAGGG + Intronic
1074699004 10:116076678-116076700 ATTTCTGTGTAGCAGAAACATGG + Intronic
1077664183 11:4093397-4093419 TTTTCTCTCATGCAGTATCTGGG + Intergenic
1078537967 11:12190277-12190299 ATTTGTCTCTTGAAGAATCAGGG + Intronic
1079597920 11:22274818-22274840 CTTTCTGTCTTACAATATAAAGG + Intronic
1080524521 11:33101172-33101194 CTTACTGTCTTGAAGTAACATGG + Intronic
1080722195 11:34860796-34860818 CTTACTGTCTTACAGTAGCAAGG + Intronic
1087753034 11:102026294-102026316 ATTTGTGTGTTGCAATATCAGGG - Intergenic
1087901359 11:103645278-103645300 AGTCCTGTCTCTCAGTATCAAGG + Intergenic
1087906929 11:103709287-103709309 AGATCTGGCTTGCGGTATCAGGG + Intergenic
1088271671 11:108040811-108040833 TTCTCTGCCTTGCTGTATCAGGG - Intronic
1089039975 11:115438329-115438351 AATTCTGTCTTTCAGTAGCCTGG + Intronic
1090718553 11:129452209-129452231 ATATCTGCATTGCAGTTTCAGGG - Exonic
1095888152 12:47210040-47210062 ATTTCTGTCTTGGGGTAACCGGG + Intronic
1096366012 12:51028905-51028927 ACTTCTGTCTTGTAGTCTCTGGG - Intergenic
1099187816 12:79534974-79534996 ACTTTAATCTTGCAGTATCAAGG - Intergenic
1100817121 12:98397238-98397260 ATTTGTTTTTTCCAGTATCATGG - Intergenic
1101264558 12:103070074-103070096 ATTTTTGTCTTACAGTGGCAAGG - Intergenic
1105046762 12:133010236-133010258 GTCTCTGTCTTGAAGAATCATGG - Exonic
1105223148 13:18352827-18352849 ATTTTTTTCTTGCATTAACAGGG - Intergenic
1105319194 13:19301067-19301089 ATTCCTGTCTTCTAGAATCAGGG - Intergenic
1106286688 13:28324222-28324244 ATTGCTGTCTAGCAGAATCTAGG - Intronic
1107396616 13:40024720-40024742 ATTTCTTTCTTGCACTGTGAAGG - Intergenic
1108116671 13:47136177-47136199 ATTTCTTTTTTGCAGTATCATGG - Intergenic
1109133535 13:58618673-58618695 CCTTCTGTCTTGAAGTCTCAAGG - Intergenic
1109436963 13:62316137-62316159 ATTTCTGTACTGCACTCTCATGG + Intergenic
1109598924 13:64597335-64597357 ATTTTTCTCTTTCAGTAACATGG + Intergenic
1109987395 13:70007155-70007177 ATTTCTGATTTGTATTATCACGG - Intronic
1110614311 13:77524014-77524036 GTTTCTGTATTGCAGAATTATGG + Intergenic
1111093057 13:83472716-83472738 TTTTCTGGCTTGGAATATCAGGG - Intergenic
1112846425 13:103648629-103648651 ATCCCTGTCTGGCAGTAACAAGG - Intergenic
1113570944 13:111357199-111357221 ATTGCTTTCTTCCTGTATCAAGG - Intergenic
1114063520 14:19039910-19039932 ATTTCTTTCTGGCAGGCTCATGG + Intergenic
1114098736 14:19360086-19360108 ATTTCTTTCTGGCAGGCTCATGG - Intergenic
1114347102 14:21807866-21807888 ATTTCTCTCTTTGGGTATCAAGG + Intergenic
1114594511 14:23899620-23899642 ATTACTGACTTGCAGTAGAAGGG + Intergenic
1114951256 14:27756959-27756981 ATTGCTGTCTGGAAGAATCATGG - Intergenic
1114982869 14:28188391-28188413 ATTTCTTTATTGCATTATCTTGG - Intergenic
1116594898 14:46828594-46828616 ATTTCTGTGTTGGAATATAATGG - Intergenic
1117203156 14:53413060-53413082 CTTTCTGTCTTTGAGTGTCAGGG + Intergenic
1117891930 14:60431383-60431405 GTTTCTGTGTTGCAGTCTCAAGG - Intronic
1118254824 14:64196442-64196464 AATTCTATTTTGCAGTATAAAGG - Intronic
1119151252 14:72361644-72361666 AGCTCAGTCTTCCAGTATCATGG - Intronic
1119622493 14:76142149-76142171 ATTTCTGTTTTGTAGCAGCAGGG + Intergenic
1120030260 14:79632995-79633017 TTTTCTTATTTGCAGTATCATGG - Intronic
1122381809 14:101313208-101313230 ATTTCTATCTTGCATTAGCATGG - Intergenic
1123670771 15:22654612-22654634 ATCTCTGTATTACAGTATAACGG - Intergenic
1126886301 15:53154718-53154740 TTTTCTCTCTTGCTTTATCAGGG - Intergenic
1127607344 15:60600200-60600222 ATTTTTGTCATGCATGATCAAGG + Intronic
1128021392 15:64393571-64393593 ATTTCTGGGTTGTAGTATTATGG - Intronic
1131079408 15:89522362-89522384 ATGTCATTCTTGCAGGATCATGG - Intergenic
1131945935 15:97621214-97621236 ATTTATGTCTTGCATTATTTGGG + Intergenic
1133469698 16:6062919-6062941 ATTTCTGTGTTACAGTCTTAAGG + Intronic
1133708700 16:8380279-8380301 ATATCTGTCTTACAGGATTATGG - Intergenic
1134192941 16:12136481-12136503 ATTTTTTTCTTGCAGTAGCTGGG + Intronic
1135353778 16:21752472-21752494 AGTTCTGTCTTGCAGGAGCTTGG + Exonic
1135452267 16:22568610-22568632 AGTTCTGTCTTGCAGGAGCTTGG + Intergenic
1136005650 16:27327097-27327119 GTTTCTGTCGTGGAGTTTCAGGG + Intronic
1137633511 16:49965697-49965719 ATTACTGTTTTGGAGTATAAAGG + Intergenic
1138690081 16:58759075-58759097 ATTTATGTCTTGCAGCAACATGG - Intergenic
1140103977 16:71942344-71942366 ATTTCTTTCTTGCAGGATTTTGG - Intronic
1143301554 17:5914259-5914281 ATTTCTGACTTGCAGCATCAAGG - Intronic
1144276499 17:13673707-13673729 AACTCTGTCTTGCAGTGTCCTGG - Intergenic
1145194094 17:20871724-20871746 ATGTCTGTCTTTCAGGAACAGGG - Intronic
1145874634 17:28307466-28307488 ATTTCTCTCTTCCAGCAGCAAGG - Intergenic
1146558846 17:33850827-33850849 ATTTGGGGCTTGCAGTATCTCGG + Intronic
1149008008 17:51825868-51825890 AGTCCTATCTTGGAGTATCAGGG - Intronic
1151705783 17:75766309-75766331 ATTTCAGTCTTTCAGTTTCAAGG - Intergenic
1153619700 18:6965732-6965754 ATTTCTGTCTTTCAGTCTTTTGG - Intronic
1155377045 18:25170790-25170812 ATTTCTCCCTTGGAGTTTCAAGG + Intronic
1156870954 18:41944518-41944540 TGGTCTGTCTTGCTGTATCATGG + Intergenic
1156942968 18:42793285-42793307 ATTTCTGTCTGGCAGTATAGGGG - Intronic
1159509008 18:69372132-69372154 ATTTCTGTCTTGCATTTTGTGGG - Intergenic
1159797921 18:72867101-72867123 CTTTCTGTATTGCAGCATCGTGG - Intronic
1160799173 19:959903-959925 ATTTCTGTCTTGCAGCCTTGTGG + Intronic
1162707034 19:12562850-12562872 ACATGTGTCTTGCAGTTTCAAGG - Intronic
1162882576 19:13671000-13671022 ATTTTTGTACTGCAGCATCAGGG - Intergenic
1164709764 19:30347429-30347451 AGTTCTGTCTTGCAGGCTCTGGG - Intronic
1165368803 19:35389107-35389129 CTTTCTCTACTGCAGTATCATGG + Intergenic
1166060446 19:40322273-40322295 AGCTCTGTCTTGCAGTATGCCGG - Exonic
925647902 2:6055784-6055806 ATGACTGTCTTGCAGAATCAAGG - Intergenic
926343360 2:11923154-11923176 ATTTCTGTGTTGCAGTCTGGAGG + Intergenic
927474341 2:23401028-23401050 ATTCCTGCCTTCCAGTAACATGG + Intronic
927624333 2:24698226-24698248 AATTCTGACTTGAAGAATCAAGG + Intronic
929107895 2:38381708-38381730 ATTTCCCTCTTGCATTAACAAGG - Intergenic
929236507 2:39610754-39610776 ACTTCTGTCTCCCAGGATCAAGG + Intergenic
929319244 2:40521345-40521367 CTTTCTGTGTTCAAGTATCACGG + Intronic
929429771 2:41877359-41877381 TTTTCTGTCTTGCTGTCTGAAGG - Intergenic
929676034 2:43930721-43930743 ATTACTGTCTTTGTGTATCAGGG - Intronic
930425027 2:51202128-51202150 CTTTCAGTGTTGAAGTATCACGG + Intergenic
931441188 2:62291868-62291890 ATTTCTTTACTGCAGTACCACGG + Intergenic
931755502 2:65370717-65370739 CTTTCTGTCTTGCGGTAGGAGGG + Intronic
933367428 2:81371219-81371241 ATTTCTATCTGGCAGAATTATGG - Intergenic
935284407 2:101551258-101551280 ATTGCTGCCTTTCAGTGTCAGGG - Intergenic
935334570 2:102004554-102004576 ATTTCTTTCTTCCAGTAAGAAGG + Intronic
936496470 2:113026225-113026247 ATTTCTCTCTTCCAGCTTCAGGG - Exonic
937069399 2:119051160-119051182 ATTCCTTTTTTGCAGGATCAAGG - Intergenic
937475436 2:122211007-122211029 ATTCCTGTCTTGCAGGATGATGG - Intergenic
938212352 2:129479286-129479308 ATTTCTGTGCTGCAGGATCAGGG - Intergenic
939586042 2:144007354-144007376 ATTCTTGTCGTGCAGTATCAAGG + Exonic
942595889 2:177591602-177591624 ACTTCTATCTTCCAGCATCAGGG - Intergenic
943179609 2:184525496-184525518 ATTCCTGTCTTCTAATATCACGG - Intergenic
944345792 2:198664266-198664288 CTCTCTGTCTTGCATTATCTTGG + Intergenic
944395464 2:199261657-199261679 ATTTCTGTAATGCATAATCAAGG - Intergenic
945474642 2:210266620-210266642 ATTTCTATGTTGCAGTCTGAAGG - Intergenic
945530019 2:210941540-210941562 ATTTCTCCATTGAAGTATCATGG - Intergenic
946698724 2:222388094-222388116 AGTTCAGTCTTGCTGTCTCAGGG - Intergenic
947332118 2:229040552-229040574 AGTTGTGACTTGCAGAATCATGG + Intronic
947391079 2:229640092-229640114 ATTTCAGTGGTGCAGTAGCAAGG - Intronic
948478495 2:238236464-238236486 ATTATTGTCTTGCAGTTCCACGG - Intergenic
1169826121 20:9770643-9770665 ATTACTGTCTTGCATTTTCTAGG - Intronic
1173855659 20:46248954-46248976 ATTTCTACCTTGCAGTTTAAGGG + Intronic
1175142153 20:56868873-56868895 ATTTCTATCTTGTTGTCTCAGGG - Intergenic
1175793995 20:61760026-61760048 ATTTCTGTCTAGCAGAAGAAAGG - Intronic
1176731696 21:10505245-10505267 ATTTTTTTCTTGCATTAACAGGG - Intergenic
1177006485 21:15678948-15678970 ATTTCTGTGTTACAATCTCAAGG + Intergenic
1178056506 21:28805082-28805104 GTTTCTGTCTTGCAGAAGCAAGG + Intergenic
1178307800 21:31504914-31504936 ATTTCTGTCTTGCAGTATCAGGG - Intronic
1178345866 21:31827542-31827564 ATTTCTGGCTTACAGAATGAAGG + Intergenic
1180482014 22:15762544-15762566 ATTTCTTTCTGGCAGGCTCATGG + Intergenic
1181731447 22:24849839-24849861 ATCTCTGTCTGGCTGGATCATGG + Intronic
949343192 3:3051375-3051397 TTATCAGTCTTGCAGTATTATGG - Intronic
949416675 3:3822641-3822663 ATTTCAGTTTTGCAGTTTAATGG - Intronic
954138676 3:48594145-48594167 CTTCCTGTCTTGCAGTAGCCTGG + Intronic
954933772 3:54307970-54307992 CTTTCTGTGTTGCAGTATCTTGG + Intronic
957008514 3:74978496-74978518 ATATCTGTCTTCAGGTATCAGGG - Intergenic
957521763 3:81327544-81327566 ATCTGTGTCATGAAGTATCAGGG + Intergenic
958940776 3:100311241-100311263 TTTCATGTCTTGCAGTATCCTGG + Intronic
960595542 3:119404581-119404603 CTTTCTGTTGTGCAGTAGCAGGG + Intronic
960749490 3:120931415-120931437 ATTTTTGTCTTGCTTTATTACGG + Intronic
962649525 3:137474442-137474464 ATTTCTTACCTGCAGAATCATGG + Intergenic
963390467 3:144657353-144657375 ATTTCTCTCTTTCCCTATCAGGG + Intergenic
968276452 3:197444159-197444181 ATTTCTTTCCTGAAGGATCAGGG - Intergenic
969871706 4:10108809-10108831 ATTTCTAGCTTGGAGCATCAGGG - Intronic
970325812 4:14924640-14924662 ATTTCTATGTTGCAGTCTCTAGG + Intergenic
971153462 4:24058326-24058348 ATTTCTGTCTTGGATTATGTTGG + Intergenic
972741295 4:41889171-41889193 ATTTCTTTCTTACAAAATCATGG + Intergenic
972998061 4:44907717-44907739 ATTTCTGTATTTCTGTATAAAGG - Intergenic
973972568 4:56228099-56228121 ATTTCAGTCTTGGAGTAACGGGG - Intronic
974237589 4:59201668-59201690 ATTTCAGTCTGGAAGTATTATGG + Intergenic
975642153 4:76511626-76511648 ACTTCTGTCTTCCAGGATCGGGG + Intronic
975944101 4:79683705-79683727 ATTTCAGTCTTGCCATTTCAGGG - Intergenic
977337618 4:95718359-95718381 ATTTATTTCTCACAGTATCAGGG + Intergenic
977404845 4:96583973-96583995 ATTTTTGTTTTGAAGTATTAGGG - Intergenic
978445100 4:108772758-108772780 ATCTCTGTTTAGTAGTATCATGG + Intergenic
978846772 4:113282459-113282481 ATATCTGTCTTACAGTAGAATGG + Intronic
979081606 4:116350720-116350742 CTTCCTGTCTTGCACTCTCATGG + Intergenic
980254224 4:130356286-130356308 ATTTCTGTCTCAGAGTGTCAGGG + Intergenic
982968403 4:161946408-161946430 ATTTATGACTTTCAGTATAATGG - Intronic
983367344 4:166809851-166809873 ATTTTTGTCTTGCTCCATCATGG - Intronic
985209200 4:187573647-187573669 AATTATGTCTTGCAGCAACATGG - Intergenic
987858283 5:23450016-23450038 ATTACTGACATGCAGTACCAAGG - Intergenic
987870954 5:23615810-23615832 ATTTCTAACTTGCATAATCATGG + Intergenic
990963236 5:61416709-61416731 AATTCTGTCTTGCAATCTAATGG - Intronic
991899488 5:71444530-71444552 TTTTATGTCATACAGTATCAAGG + Intergenic
992596814 5:78355693-78355715 ATTTCAGTCTTACAGACTCAAGG - Intergenic
993888981 5:93449780-93449802 ATTATTGTCTTGCATTAACAAGG + Intergenic
994043246 5:95282406-95282428 ATTTTTTTCTTTCACTATCAAGG - Intronic
995470409 5:112495958-112495980 ATTTCTGTCTTCTAGTAACAGGG + Intergenic
995671226 5:114605432-114605454 ATTTCTATCTTGCCTTATCTAGG + Intergenic
1001281228 5:170387867-170387889 ATTTATGTCTCACAGTATCTGGG - Intronic
1001434459 5:171688538-171688560 CTTTATGTCTTGGAGTACCAAGG + Intergenic
1003822675 6:9917297-9917319 ATTTCTGTATTTCAGTAAAAAGG + Intronic
1007146537 6:39639750-39639772 ATTTCTTTATTGCAGTGTCCTGG - Exonic
1007825863 6:44600169-44600191 ATTTCTCTCTTGCTTTCTCAGGG + Intergenic
1007850510 6:44798421-44798443 ATTCCTGTCTTGCAGGATTTGGG - Intergenic
1013579971 6:111523889-111523911 GTTTCTGGCTTCCAGTAACATGG + Intergenic
1013795859 6:113888269-113888291 AGATCTGTTTTGCAGTAACATGG + Intergenic
1015207954 6:130662180-130662202 ATTTCTCTCATACAGTTTCAGGG + Intergenic
1015243064 6:131047663-131047685 GGTTCTGTCTGGCAGTATCGAGG - Intronic
1015841104 6:137478280-137478302 ATTTCTGTGTTACAGTCTCGAGG + Intergenic
1016387507 6:143542782-143542804 ATCTCTGTCTTGCTGTATAAAGG - Intronic
1016644091 6:146384014-146384036 ATTTCTGTCTTTCTGTCTCCAGG - Intronic
1016698917 6:147031891-147031913 ATTTATGTCTTTCAGGAACATGG + Intergenic
1016996965 6:149967567-149967589 ATTTATATCTAGCAGTATCCGGG + Intronic
1017221934 6:151975569-151975591 ATTTCTCTGCTGCAGTCTCAAGG + Intronic
1017275785 6:152566337-152566359 ATTTTCGTTTTGCAGTGTCAAGG + Intronic
1019400929 7:853388-853410 ATTTCTCTCTTGCCATTTCAGGG + Exonic
1021149549 7:17132790-17132812 ATTTTTGTATTTCAGAATCAGGG + Intergenic
1024011912 7:45274324-45274346 ACTTCTGTCTTCCGGTATCCTGG + Intergenic
1024701263 7:51906731-51906753 TTTTTTCTCTTGCAGTATCTTGG - Intergenic
1027746750 7:82084676-82084698 ATATTTTTCTTACAGTATCAGGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028213049 7:88099094-88099116 ATTTTTGTCTTGCAGGAAAATGG + Intronic
1030623471 7:111817707-111817729 ATTTCTGTCTTTTACTAACAGGG + Intronic
1031851414 7:126868464-126868486 ATTTCTCTCTTCCAACATCAAGG - Intronic
1032105375 7:129024709-129024731 ATTTATCTGTTGAAGTATCAGGG - Intronic
1034239999 7:149603023-149603045 ATTTTTGTCTTTAAGTAACAGGG - Intergenic
1034597896 7:152216224-152216246 ATTTTTTTCTTGCATTAACAGGG + Intronic
1035527764 8:327036-327058 GTTTCTGTCCTGCAGTGTCTGGG - Intergenic
1037072062 8:14662960-14662982 ATCTCAGTCTTACAGTCTCAAGG + Intronic
1038284510 8:26194865-26194887 AGTTCTCTCTTGCAGTGCCAGGG - Intergenic
1038619530 8:29126968-29126990 TTTTGTGTCTTGCATTTTCATGG - Intronic
1039194653 8:35017537-35017559 ATTTCTTTCCTGCAGTGGCAAGG - Intergenic
1039363110 8:36901693-36901715 ATTTCTGTCTGGGAGCATCCAGG - Intronic
1042437699 8:68786523-68786545 AACTCTGCCTTGCAGGATCAGGG + Intronic
1042880957 8:73488394-73488416 ATTTATGTCTTGCTGGTTCAAGG + Intronic
1042881621 8:73499052-73499074 ATTTCTGTGTTACAGTCTTAAGG - Intronic
1043800426 8:84602865-84602887 ATTTCTGTCTTTGAGAATAATGG + Intronic
1044407684 8:91847942-91847964 ATTTCAGTATTACAGTATCCTGG - Intergenic
1044657369 8:94562486-94562508 ATTATTGTCTTGCAGTAGCTTGG + Intergenic
1045229937 8:100294586-100294608 CTTACTGGCTTGAAGTATCAGGG - Intronic
1045647917 8:104317442-104317464 CTTTCTTAATTGCAGTATCATGG - Intergenic
1045675426 8:104602288-104602310 GTTTCTATGTTGCAGTATCAAGG - Intronic
1046813196 8:118554817-118554839 ATTTCTATGTTGCAGTCTTAAGG - Intronic
1047817810 8:128483949-128483971 CTTTCTGTCCTGAAATATCAGGG - Intergenic
1048963371 8:139597863-139597885 ATTTCTCTCTTGCAGGGTTATGG - Intergenic
1049051692 8:140202320-140202342 TTTTCTGTTTTTGAGTATCATGG - Intronic
1050685193 9:8160669-8160691 ATTACTTTCTTCCAATATCAGGG - Intergenic
1055599297 9:77898745-77898767 ATTTCTGAGTTGTAGAATCAAGG - Intronic
1056799121 9:89679154-89679176 ATTTCTGTCTTCCAGGACCCTGG - Intergenic
1057990676 9:99766424-99766446 ATTCCTCTTTTGCAGTATCATGG + Intergenic
1059167286 9:112090038-112090060 TTTTCTGTCTCACAATATCAGGG - Intronic
1060932137 9:127495949-127495971 GTTTCTGTCTTGCAGGAAGAGGG + Exonic
1186984448 X:14996832-14996854 ATTTCTGGCTTGCATCAGCATGG - Intergenic
1188355508 X:29185639-29185661 TTTTATGACTTGGAGTATCATGG - Intronic
1190126476 X:47709923-47709945 AACTCTATCTTCCAGTATCAGGG - Intergenic
1191848847 X:65570731-65570753 AGATCTGTCTTGCAATTTCAAGG - Intergenic
1192612745 X:72584295-72584317 TTTTCTGTTTTGCAGTGTCACGG - Exonic
1192753156 X:74015991-74016013 ATTGCTTTCCTGCATTATCATGG - Intergenic
1192930613 X:75801870-75801892 ATTTCTGTGGTAGAGTATCAGGG - Intergenic
1193553038 X:82922773-82922795 TTTTCTGTTTTGCATTATCTTGG + Intergenic
1195259187 X:103116070-103116092 ATTTCTGTTGTGCAGTGTTATGG - Intergenic
1195437419 X:104861392-104861414 ATGTCTGTCTTCCACTATAAAGG - Intronic
1195716483 X:107823644-107823666 ATTTCAGTCATGCAGGATGAGGG - Intergenic
1195736583 X:108018453-108018475 TTTTCTGTCTTCCATTATCAAGG - Intergenic
1196181238 X:112692714-112692736 ATTTCTGTGTTGCCATCTCAAGG + Intergenic
1197991511 X:132323297-132323319 ATTTCTGTGTTGCACTAGAAAGG + Intergenic
1198085228 X:133276477-133276499 ATTTATGTATTGCATTAGCATGG + Intergenic
1199026277 X:142942529-142942551 ATTTCTGCTTGGCAGTAACAAGG + Intergenic
1199109220 X:143910466-143910488 ATTTTTGTTATGCAGTAGCAAGG - Intergenic
1199320975 X:146438992-146439014 TATTGTGTCTTGCAATATCATGG + Intergenic
1201675689 Y:16581146-16581168 ATTACTGTTTTGTGGTATCAAGG + Intergenic
1202369460 Y:24187139-24187161 CCTCCTGTCTGGCAGTATCATGG - Intergenic
1202501325 Y:25482978-25483000 CCTCCTGTCTGGCAGTATCATGG + Intergenic