ID: 1178318414

View in Genome Browser
Species Human (GRCh38)
Location 21:31586220-31586242
Sequence CTGAACAAAACAGCAGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178318411_1178318414 -1 Left 1178318411 21:31586198-31586220 CCACCAACTGTTCTTTCTTTATC No data
Right 1178318414 21:31586220-31586242 CTGAACAAAACAGCAGTGGTCGG No data
1178318410_1178318414 3 Left 1178318410 21:31586194-31586216 CCTTCCACCAACTGTTCTTTCTT No data
Right 1178318414 21:31586220-31586242 CTGAACAAAACAGCAGTGGTCGG No data
1178318407_1178318414 23 Left 1178318407 21:31586174-31586196 CCAAATCCTTGATTGGGCCTCCT No data
Right 1178318414 21:31586220-31586242 CTGAACAAAACAGCAGTGGTCGG No data
1178318409_1178318414 6 Left 1178318409 21:31586191-31586213 CCTCCTTCCACCAACTGTTCTTT No data
Right 1178318414 21:31586220-31586242 CTGAACAAAACAGCAGTGGTCGG No data
1178318408_1178318414 17 Left 1178318408 21:31586180-31586202 CCTTGATTGGGCCTCCTTCCACC No data
Right 1178318414 21:31586220-31586242 CTGAACAAAACAGCAGTGGTCGG No data
1178318412_1178318414 -4 Left 1178318412 21:31586201-31586223 CCAACTGTTCTTTCTTTATCTGA No data
Right 1178318414 21:31586220-31586242 CTGAACAAAACAGCAGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178318414 Original CRISPR CTGAACAAAACAGCAGTGGT CGG Intergenic
No off target data available for this crispr