ID: 1178319676

View in Genome Browser
Species Human (GRCh38)
Location 21:31595917-31595939
Sequence TCTCCCTGCTTGTGTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178319673_1178319676 -8 Left 1178319673 21:31595902-31595924 CCAAGAAAAGTTCCCTCTCCCTG No data
Right 1178319676 21:31595917-31595939 TCTCCCTGCTTGTGTTCCTGAGG No data
1178319671_1178319676 24 Left 1178319671 21:31595870-31595892 CCTGTATATTTAATGTGGATTGC No data
Right 1178319676 21:31595917-31595939 TCTCCCTGCTTGTGTTCCTGAGG No data
1178319672_1178319676 -7 Left 1178319672 21:31595901-31595923 CCCAAGAAAAGTTCCCTCTCCCT No data
Right 1178319676 21:31595917-31595939 TCTCCCTGCTTGTGTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178319676 Original CRISPR TCTCCCTGCTTGTGTTCCTG AGG Intergenic
No off target data available for this crispr