ID: 1178320975

View in Genome Browser
Species Human (GRCh38)
Location 21:31605434-31605456
Sequence GGAGAACAGCACCAAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178320975_1178320984 25 Left 1178320975 21:31605434-31605456 CCATCCCCTTGGTGCTGTTCTCC No data
Right 1178320984 21:31605482-31605504 CCTGGTCGTTTAAAAGTGTGTGG No data
1178320975_1178320981 7 Left 1178320975 21:31605434-31605456 CCATCCCCTTGGTGCTGTTCTCC No data
Right 1178320981 21:31605464-31605486 GAGTGTGTCCTTGCGAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178320975 Original CRISPR GGAGAACAGCACCAAGGGGA TGG (reversed) Intergenic
No off target data available for this crispr