ID: 1178321489

View in Genome Browser
Species Human (GRCh38)
Location 21:31609532-31609554
Sequence GATGGTCAGCAGCACTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178321489_1178321496 26 Left 1178321489 21:31609532-31609554 CCTATGGAGTGCTGCTGACCATC No data
Right 1178321496 21:31609581-31609603 GGCCCACCAGGCCAGCTCAAGGG No data
1178321489_1178321493 5 Left 1178321489 21:31609532-31609554 CCTATGGAGTGCTGCTGACCATC No data
Right 1178321493 21:31609560-31609582 AGAAAGGCTCAGAGAGAAGAGGG No data
1178321489_1178321494 14 Left 1178321489 21:31609532-31609554 CCTATGGAGTGCTGCTGACCATC No data
Right 1178321494 21:31609569-31609591 CAGAGAGAAGAGGGCCCACCAGG No data
1178321489_1178321495 25 Left 1178321489 21:31609532-31609554 CCTATGGAGTGCTGCTGACCATC No data
Right 1178321495 21:31609580-31609602 GGGCCCACCAGGCCAGCTCAAGG No data
1178321489_1178321492 4 Left 1178321489 21:31609532-31609554 CCTATGGAGTGCTGCTGACCATC No data
Right 1178321492 21:31609559-31609581 CAGAAAGGCTCAGAGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178321489 Original CRISPR GATGGTCAGCAGCACTCCAT AGG (reversed) Intergenic
No off target data available for this crispr