ID: 1178321501

View in Genome Browser
Species Human (GRCh38)
Location 21:31609592-31609614
Sequence CCTTCTCCAGGCCCTTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178321501_1178321505 -1 Left 1178321501 21:31609592-31609614 CCAGCTCAAGGGCCTGGAGAAGG No data
Right 1178321505 21:31609614-31609636 GTGCTGGAAAAAATTACTCTTGG No data
1178321501_1178321507 21 Left 1178321501 21:31609592-31609614 CCAGCTCAAGGGCCTGGAGAAGG No data
Right 1178321507 21:31609636-31609658 GTCCCGAGACCAGCTCGGTCAGG No data
1178321501_1178321506 16 Left 1178321501 21:31609592-31609614 CCAGCTCAAGGGCCTGGAGAAGG No data
Right 1178321506 21:31609631-31609653 TCTTGGTCCCGAGACCAGCTCGG No data
1178321501_1178321508 22 Left 1178321501 21:31609592-31609614 CCAGCTCAAGGGCCTGGAGAAGG No data
Right 1178321508 21:31609637-31609659 TCCCGAGACCAGCTCGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178321501 Original CRISPR CCTTCTCCAGGCCCTTGAGC TGG (reversed) Intergenic
No off target data available for this crispr