ID: 1178321950

View in Genome Browser
Species Human (GRCh38)
Location 21:31612676-31612698
Sequence CAAAAGAAGGGGAACGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178321950_1178321959 8 Left 1178321950 21:31612676-31612698 CCTGCCTCGTTCCCCTTCTTTTG No data
Right 1178321959 21:31612707-31612729 TCCTTGGTAAAGCCTTTACAAGG No data
1178321950_1178321955 -8 Left 1178321950 21:31612676-31612698 CCTGCCTCGTTCCCCTTCTTTTG No data
Right 1178321955 21:31612691-31612713 TTCTTTTGTGAGCCCCTCCTTGG No data
1178321950_1178321966 28 Left 1178321950 21:31612676-31612698 CCTGCCTCGTTCCCCTTCTTTTG No data
Right 1178321966 21:31612727-31612749 AGGGATTTGGAGGTGTAGGTAGG No data
1178321950_1178321961 9 Left 1178321950 21:31612676-31612698 CCTGCCTCGTTCCCCTTCTTTTG No data
Right 1178321961 21:31612708-31612730 CCTTGGTAAAGCCTTTACAAGGG No data
1178321950_1178321962 15 Left 1178321950 21:31612676-31612698 CCTGCCTCGTTCCCCTTCTTTTG No data
Right 1178321962 21:31612714-31612736 TAAAGCCTTTACAAGGGATTTGG No data
1178321950_1178321965 24 Left 1178321950 21:31612676-31612698 CCTGCCTCGTTCCCCTTCTTTTG No data
Right 1178321965 21:31612723-31612745 TACAAGGGATTTGGAGGTGTAGG No data
1178321950_1178321963 18 Left 1178321950 21:31612676-31612698 CCTGCCTCGTTCCCCTTCTTTTG No data
Right 1178321963 21:31612717-31612739 AGCCTTTACAAGGGATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178321950 Original CRISPR CAAAAGAAGGGGAACGAGGC AGG (reversed) Intergenic
No off target data available for this crispr