ID: 1178329471

View in Genome Browser
Species Human (GRCh38)
Location 21:31675220-31675242
Sequence AGGCCCTATATGCCATAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178329471 Original CRISPR AGGCCCTATATGCCATAAGG AGG Intronic
903536951 1:24073271-24073293 AGGCCCCATGTGCCATGAGCAGG + Intronic
903589932 1:24447099-24447121 AGGCCTTATGTGCCATACTGAGG + Intronic
904603018 1:31683999-31684021 TGGCCCTAAAAGGCATAAGGTGG + Exonic
918069621 1:181125402-181125424 AGGCCTTATATGCCATGGGGAGG + Intergenic
921304164 1:213779225-213779247 CGGCCCTGAGTGCCATAAGGAGG + Intergenic
1066012449 10:31207291-31207313 AGGCCCTTTATGCCATGAATGGG + Intergenic
1068133957 10:52932043-52932065 ACACCCAATATGCCATATGGTGG - Intergenic
1071336805 10:84607043-84607065 TGGCTCTATTTGCCAAAAGGAGG + Intergenic
1075641619 10:124068913-124068935 GGGCCCAAAATACCATAAGGTGG - Intronic
1078606752 11:12784000-12784022 AGGCTCTATCTCCCATAAGGAGG + Intronic
1081327771 11:41767057-41767079 AGGCCCTATCTCCCATATTGGGG + Intergenic
1098143253 12:67472164-67472186 AGGCCCTATAATCCAAAAAGAGG - Intergenic
1098652558 12:72991437-72991459 AGGCCCCATCTGCCTCAAGGAGG + Intergenic
1104231486 12:126888880-126888902 AGGATCAATATGACATAAGGAGG - Intergenic
1105067675 12:133215030-133215052 AGACCCTGTGTGCCCTAAGGAGG - Intergenic
1108426746 13:50310054-50310076 AGTCCCTCTTTGCCTTAAGGTGG - Intronic
1110959095 13:81598146-81598168 AGGCCCTATATCCAATACCGGGG - Intergenic
1123136331 14:106030843-106030865 AGGCCCTAAGTGCCAAAAGCTGG - Intergenic
1127850830 15:62910454-62910476 AGGCCTTCCATGCCAGAAGGTGG - Intergenic
1134807970 16:17141707-17141729 AAGACCTCTATGGCATAAGGAGG - Intronic
1139900474 16:70324100-70324122 AGGACCTGTATGCCATTATGAGG + Intronic
1150603846 17:66674894-66674916 AGGCCCTCCATGGCATAAGGAGG - Intronic
1161344496 19:3761357-3761379 AGACCCAAGACGCCATAAGGCGG + Intronic
1166596707 19:44056558-44056580 AGGCATTTTATGCCATAAGGAGG - Intronic
932915144 2:75849750-75849772 AGAACCTATATGACATAAAGTGG - Intergenic
937317714 2:120942468-120942490 GGGCCCTACATGCCATCATGGGG - Intronic
948290093 2:236818219-236818241 TGGCCCTGTGTGCCATCAGGAGG - Intergenic
948715081 2:239856016-239856038 TGGCCCTATCTGCCAGGAGGTGG + Intergenic
1170013782 20:11757583-11757605 AGGCCATATACTCCATATGGAGG - Intergenic
1170262958 20:14432105-14432127 AGGCCCTGTACGCTCTAAGGAGG - Intronic
1175352960 20:58338939-58338961 AGGCACTATATGCCATTATGGGG + Intronic
1178329471 21:31675220-31675242 AGGCCCTATATGCCATAAGGAGG + Intronic
1181897683 22:26125289-26125311 AGGCTCTGTATGGCATAATGTGG + Intergenic
1182709269 22:32310490-32310512 AGGCCCATGTTGCCATAAGGGGG - Intergenic
1185016891 22:48349482-48349504 AATCCCTACATGCCAAAAGGGGG + Intergenic
956559388 3:70557551-70557573 AGGACCTAAATGCCAGAATGTGG + Intergenic
957947744 3:87086891-87086913 GGGCCTTATAGGCCATAATGGGG - Intergenic
966636654 3:182141973-182141995 AGGCACTGTATGCCACAATGTGG + Intergenic
969595615 4:8147964-8147986 AGGCCCAATATCCCAGAAGAAGG + Intronic
976214954 4:82707459-82707481 AGGCCATGCATGCCAGAAGGTGG - Intronic
978499832 4:109397450-109397472 AAGCTCTTTATGCCATAAGTGGG - Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
982217140 4:153092157-153092179 GGGCCCTAAATGCCATCAAGAGG - Intergenic
992169781 5:74090204-74090226 AGGACCTACATGTCATAAGATGG - Intergenic
999725356 5:154432420-154432442 AGGCCCTATCTCCCATTTGGGGG + Intergenic
1002103158 5:176867311-176867333 AGGCCAGATATGGCAGAAGGTGG + Intronic
1003549541 6:7090757-7090779 AGGCCCCATATGCCACAGGACGG - Intergenic
1013332530 6:109119176-109119198 GAGCCCTATATGCCCTGAGGAGG + Intronic
1016014849 6:139173210-139173232 GGGGCCTTTATGCCAAAAGGGGG - Intronic
1030685612 7:112484242-112484264 AGGACTTACATGCCATATGGAGG + Intronic
1036944382 8:13080978-13081000 AGGTCCTATGTGTCACAAGGAGG + Intergenic
1046768163 8:118092569-118092591 AGGCCCTGAAAGACATAAGGAGG + Intronic
1046973965 8:120252851-120252873 TGGCCCTATATGCAATCGGGGGG - Intronic
1048054738 8:130852676-130852698 AGGCCCTGTATGCCATGTGGAGG - Intronic
1051029644 9:12658658-12658680 AGGCCGTTTATGCCAAAGGGTGG + Intergenic
1060866547 9:127003958-127003980 AGGCCCAAGATGCCAGAAAGAGG - Intronic
1189729658 X:44005595-44005617 AGGCCCTTTATTCAAAAAGGTGG + Intergenic
1197270179 X:124416912-124416934 AGTCCTTATATGACAGAAGGGGG - Intronic