ID: 1178331449

View in Genome Browser
Species Human (GRCh38)
Location 21:31697630-31697652
Sequence GTCTATAAGCAGAATGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178331449 Original CRISPR GTCTATAAGCAGAATGAGCA CGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901310749 1:8267722-8267744 CTCTATTAGCAGCATGAGAATGG - Intergenic
903124301 1:21237285-21237307 GTCTATATCCAGCCTGAGCATGG - Intronic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
904885316 1:33733314-33733336 GAATATAAGCAGAATGAACTTGG + Intronic
908563425 1:65330164-65330186 GTCCATAAGGAGAATGACTAGGG - Intronic
909410536 1:75345333-75345355 ATCTATAAGCAGTATGATCTTGG + Intronic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
909622698 1:77685047-77685069 CTCTATAAGTAGAAAGAGCAAGG - Intergenic
909901636 1:81144278-81144300 GTCTATAAACAAAAAGAGAATGG - Intergenic
910708250 1:90152838-90152860 GTCTATTAGCAGCATAAGAATGG - Intergenic
911848281 1:102782834-102782856 GTCTATTAGCAGCATAAGAATGG - Intergenic
912671389 1:111630679-111630701 GTATATAAGAAGAATGAACCAGG + Intronic
913130307 1:115833129-115833151 GTCTAGAAGCAGCGTGAGAATGG + Intergenic
913610303 1:120504141-120504163 GTATATAAGCAGATTAAGTATGG + Intergenic
913984497 1:143552693-143552715 GTATATAAGCAGATTAAGTATGG - Intergenic
914580887 1:149018098-149018120 GTATATAAGCAGATTAAGTATGG - Intronic
916270111 1:162931744-162931766 CTATACAGGCAGAATGAGCAGGG - Intergenic
917887668 1:179402201-179402223 GTCTATCAGCAGCATGAAAATGG + Intronic
920345183 1:205301725-205301747 GTCTTTACGCAGCAGGAGCAGGG + Intergenic
921326577 1:213990206-213990228 ATCTATTAGCAGAGTGCGCATGG + Intronic
923915423 1:238497736-238497758 CTTTATAAGCAGTATGAGAATGG + Intergenic
1062815234 10:494632-494654 GTCAATATGCAGCATGAGAAAGG + Intronic
1063179315 10:3583650-3583672 GACAAAAGGCAGAATGAGCAGGG + Intergenic
1064807989 10:19159425-19159447 GGCAATAAGCAGACTGAGGAAGG + Intronic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1068329911 10:55549735-55549757 GTCTCTAAACAGATTGAGTAGGG + Intronic
1069189442 10:65468139-65468161 GTTTATCAGCAGCATGAACATGG + Intergenic
1069327294 10:67246828-67246850 TTTTACAAGCAGAATGCGCAAGG + Intronic
1071026447 10:81119994-81120016 GGCTAAAAGCAGAAAGATCAAGG - Intergenic
1071120875 10:82277412-82277434 ATCTATAAGTAAAATAAGCATGG - Intronic
1073956437 10:108876850-108876872 GTAAACAAACAGAATGAGCAGGG - Intergenic
1075941890 10:126396825-126396847 CTTTATTAGCAGCATGAGCACGG + Intergenic
1076069191 10:127472629-127472651 GGCTAAAAGAAGAATCAGCATGG - Intergenic
1078252153 11:9624991-9625013 GCCAATAACCAGAATGAGCTTGG + Intergenic
1079259770 11:18867124-18867146 TTCTATAAGGAAATTGAGCATGG - Intergenic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1080290387 11:30664528-30664550 GTTTATTAGCAGCATGAGAATGG - Intergenic
1080369026 11:31612615-31612637 GTATATAAGGAGAAAGAGAAGGG + Intronic
1080988125 11:37495718-37495740 CCCTATAAGGACAATGAGCACGG + Intergenic
1082944873 11:58747845-58747867 GTCAATAAGCAGAATAATCATGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1086506861 11:87514174-87514196 GTCTATGTGGAGGATGAGCAAGG - Intergenic
1087124331 11:94608125-94608147 GTCCATAACCAGAATGAACATGG + Intronic
1089236883 11:117036388-117036410 TTCTATAAGCACAATCAGAATGG - Intronic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1091334365 11:134755324-134755346 GTCCAGATGCAGCATGAGCAGGG - Intergenic
1093427475 12:19044660-19044682 GTTTGTATGCACAATGAGCAAGG + Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1097342584 12:58455790-58455812 GTCAGTAAGCAGAAAGAGCAAGG - Intergenic
1097777204 12:63661933-63661955 GACCATAAGCATCATGAGCAAGG + Intronic
1098445879 12:70565027-70565049 GACTATAAACATAATGACCATGG + Intronic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1100133286 12:91522354-91522376 GTTTATAAGCAGAATGCTAAAGG + Intergenic
1100378852 12:94043228-94043250 CTTTATTAGCAGAATGAGAATGG - Intergenic
1102831918 12:116010263-116010285 GTCTTTAAGCTCAATGAGCATGG + Intronic
1104190286 12:126475607-126475629 CTTTATTAGCAGAATGAGAATGG - Intergenic
1106465618 13:30011909-30011931 GTCTATTTGCAGAATGAATAAGG + Intergenic
1110456711 13:75697261-75697283 GTTTATTAGCAGCATGAGAATGG - Intronic
1110833799 13:80061953-80061975 GTCTATAAGCTTGAAGAGCAAGG + Intergenic
1110881156 13:80574337-80574359 GTTTATTAGCAGCATGAGAATGG - Intergenic
1111391885 13:87607033-87607055 TTCTATACACAGAATAAGCAAGG + Intergenic
1111505572 13:89184588-89184610 CTCTATTAGCAGCATGAGAAAGG - Intergenic
1112057188 13:95700574-95700596 GTTTAGAAGGAGAAAGAGCAAGG + Intronic
1115375328 14:32669625-32669647 GTCTATTAGCAGCGTGAGAATGG - Intronic
1116233256 14:42245537-42245559 GTCTATATGCAAAATGTGTAAGG - Intergenic
1119800783 14:77443335-77443357 GTCTCTCAGCAGCATGGGCACGG - Intronic
1120442646 14:84559584-84559606 GTCTCTAAGCACAATGAAGAAGG + Intergenic
1120831624 14:89002596-89002618 GTCTATCAGCAGCATGAAAATGG - Intergenic
1126138559 15:45416750-45416772 GTCTAAAAGCAGACAGAGAAAGG - Intronic
1126708450 15:51429523-51429545 GTCTACTAGCAGCATGAGAATGG - Intergenic
1127787145 15:62365621-62365643 CTTTATTAGCAGAATGAGAACGG + Intergenic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128884709 15:71275967-71275989 TTCTATCAGCAGCATGAGAACGG + Intronic
1130299336 15:82667951-82667973 GTCAACAAGCAGAATGCCCAAGG + Intronic
1138518451 16:57554258-57554280 GTCTCTAGGCAGAATGATAAAGG - Intronic
1203137880 16_KI270728v1_random:1740859-1740881 GTATATGTGCAGAATGTGCAGGG + Intergenic
1143224093 17:5285840-5285862 GTCTTTAAGAAGAATGAAGAAGG - Intronic
1145846715 17:28044619-28044641 GTCCCTGAGCAGAATGACCAAGG - Intronic
1148384465 17:47224017-47224039 GTTTAAAAGCAGCAAGAGCAAGG - Intergenic
1149335977 17:55636468-55636490 GTTTATATGTAGAATGAGCTAGG + Intergenic
1150092472 17:62339965-62339987 GTCTATCAGCAGCATGAAAATGG + Intergenic
1156023008 18:32620923-32620945 CTTTATTAGCAGAATGAGAATGG + Intergenic
1157099734 18:44718519-44718541 GTGGATAAGCAGCATCAGCAGGG - Intronic
1159178982 18:64876890-64876912 CTTTATTAGCAGAATGAGAATGG - Intergenic
1160294790 18:77628102-77628124 CTCTATTAGCAGCATGAGAATGG - Intergenic
1162828846 19:13271514-13271536 ATCAATTAGCAGAATGAGCTGGG - Intronic
1162991423 19:14305062-14305084 GTCATTAAGCAGAATGAGGCAGG - Intergenic
1163096809 19:15064627-15064649 CTTTATTAGCAGAATGAGGATGG - Intergenic
1167512316 19:49901878-49901900 ATCTAAAACCAGAGTGAGCAGGG + Exonic
1167719031 19:51165779-51165801 ATCTATAAACAGAATGGGCCAGG + Intergenic
925443377 2:3907435-3907457 GTCTATCAGCAGCATGAAAATGG - Intergenic
925550888 2:5073104-5073126 TTCTCTAAGCAGAATGAAAATGG + Intergenic
925698411 2:6607249-6607271 GTCTATTAGCAGCATGAGAATGG - Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
926646503 2:15295240-15295262 GTGTATAGCAAGAATGAGCATGG + Intronic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
927308032 2:21596185-21596207 CTTTATTAGCAGAATGAGAATGG + Intergenic
927753247 2:25688452-25688474 GTCTACAAGCAGAAAAAGCCTGG - Intergenic
928256043 2:29723385-29723407 GTCTCTCAGCAGGATGACCAGGG - Intronic
933486120 2:82926200-82926222 GTCAGTAATGAGAATGAGCATGG + Intergenic
934568674 2:95354545-95354567 GTCTAGAACCAGGATGTGCAGGG + Intronic
934593666 2:95583416-95583438 GTACATGAGCAGAATGTGCAGGG + Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
936573124 2:113632894-113632916 GTCTGTAAGCAGAACAGGCAAGG - Exonic
941023087 2:160430834-160430856 GTCTACAATGAGAATAAGCAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943558844 2:189437102-189437124 GATTATAAGCAGAATGATCTAGG + Intergenic
944458279 2:199917838-199917860 CTCTATTAGCAGCATGAGAATGG - Intronic
945334930 2:208581070-208581092 GTCTGTAAACAGAATAACCAGGG - Intronic
946807074 2:223481512-223481534 GTCTATCAGCAGTGTGAACACGG + Intergenic
947535315 2:230936585-230936607 GTTTATTAGCAGCATGAGAATGG + Intronic
948448382 2:238051674-238051696 GTCTATCAGCAGCATGAAAAAGG + Intronic
1169303723 20:4469919-4469941 GTCAATAATCACAATGAGGAAGG + Intergenic
1170875394 20:20245250-20245272 GTTTATCAGCAGCATGAGAATGG - Intronic
1173030347 20:39352118-39352140 GTCTATTAGCAGTGTGAGAAGGG + Intergenic
1174797016 20:53530717-53530739 GTCTATCAGCAGCATGAAAATGG + Intergenic
1174992543 20:55527202-55527224 GTCTATTAGCAGTGTGAGAAGGG + Intergenic
1176677377 21:9791824-9791846 GTTTATTAGCAGCATGAGAATGG + Intergenic
1176689150 21:9882730-9882752 GTCTATCAGCAGCATGAAAATGG - Intergenic
1177916781 21:27098858-27098880 GTCTGGAGGCAGAAGGAGCAAGG + Intergenic
1177955512 21:27593520-27593542 GTCTACAACCAGAATGAGCCTGG - Intergenic
1178098533 21:29241011-29241033 GTCTATCAGCAGGATGAAAATGG + Intronic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1180552700 22:16553416-16553438 GTATATGTGCAGAATGTGCAGGG + Intergenic
1182047204 22:27284704-27284726 GTTTTTAAGCAGAATCAGCCAGG - Intergenic
1185427061 22:50777980-50778002 GTCTGTAAGCAGAACAGGCAAGG + Exonic
949390946 3:3561598-3561620 GCCTATAACCTAAATGAGCAAGG - Intergenic
951199549 3:19862149-19862171 GTCTATCAGCAGCATGAAAATGG - Intergenic
952741650 3:36739699-36739721 CTCTATAAGCAGCATGAAAAGGG + Intronic
954164418 3:48744807-48744829 GGCTATAACCAGAACTAGCAAGG - Intronic
955555115 3:60128510-60128532 GTCTATTAGCAGCATGAAAATGG + Intronic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957787612 3:84902149-84902171 CTTTATAAGCAGAATGAAAATGG + Intergenic
959902989 3:111680687-111680709 GTCTATAAACAGAAAGATCATGG + Intronic
960036002 3:113103772-113103794 TTTCATAAGCAGAATAAGCAAGG + Intergenic
960070697 3:113426649-113426671 GTTTATTAGCAGCATGAGAACGG + Intronic
960266745 3:115628688-115628710 GCCTATAAGGAGACTGAGCAGGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
963232612 3:142924286-142924308 GCTTATTAGTAGAATGAGCATGG - Intergenic
963525493 3:146410008-146410030 GTCTAGAAGGAAAATGAGAAGGG - Intronic
965181517 3:165409655-165409677 GTCTATAATCAGAATAAAGAGGG - Intergenic
965425584 3:168518653-168518675 CTTTATTAGCAGAATGAGAATGG - Intergenic
967222492 3:187259205-187259227 GCAAATAAGCAGAATGAACAAGG - Intronic
970015379 4:11506768-11506790 GACTTTAAGCAGGATGATCAGGG - Intergenic
972426563 4:38938491-38938513 GTATACAAGCAGAATGACAAGGG + Intronic
973006742 4:45017334-45017356 GTAGATAATCAGAATGAGCCAGG - Intergenic
973114127 4:46433818-46433840 GTCTGTATGCAGAATTAGAAGGG + Intronic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974467014 4:62270788-62270810 ATCTCTTAGCAGAATGAGAATGG + Intergenic
975655177 4:76634080-76634102 GTTTATTAGCAGAGTGAGAATGG - Intronic
975668699 4:76758401-76758423 GTTTAGAAGCAGAATGGTCATGG + Intronic
975833897 4:78400240-78400262 CTCTATAAGAAGCTTGAGCAGGG - Intronic
977575748 4:98672580-98672602 TTTTATCAGCAGGATGAGCACGG - Intergenic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
980034726 4:127870848-127870870 GTTTTTAAATAGAATGAGCAGGG + Intergenic
980094449 4:128474889-128474911 GTCTGTGAGGAGAATGAGGAAGG + Intergenic
980771139 4:137374554-137374576 CACTATAATCAGAAAGAGCATGG + Intergenic
980962288 4:139487218-139487240 CACTATAAGCAGAATTAACAAGG - Intergenic
982301014 4:153879570-153879592 ATCCATAAGCACACTGAGCAAGG - Intergenic
982659304 4:158187957-158187979 ATCTATAAGAAGTATGAACATGG - Intergenic
983911808 4:173248102-173248124 GTCTATTAGAAGAATAAACAAGG + Exonic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985398159 4:189566957-189566979 GTTTATTAGCAGCATGAGAATGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
988431434 5:31123479-31123501 ATATATAAGCAAAATTAGCAAGG + Intergenic
989775748 5:45205393-45205415 GTCAATAACCTGAATGAGCTTGG - Intergenic
990172697 5:53071742-53071764 GGCTAAAAGCAGAATTAGGATGG + Intronic
992243907 5:74797926-74797948 ATATATAAGCTTAATGAGCATGG + Intronic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
994389247 5:99170929-99170951 GCCTCTAGGTAGAATGAGCATGG + Intergenic
996250939 5:121331294-121331316 CTTTATTAGCAGAATGAGAATGG + Intergenic
997730917 5:136174931-136174953 GTCTATTAGCAGCATGAAAATGG - Intronic
998650012 5:144108058-144108080 GGCTTTACGCAGAATAAGCAAGG - Intergenic
1000643079 5:163728070-163728092 ATCTATAAGTAAAATGAGCAAGG - Intergenic
1003200868 6:3959017-3959039 TTCTATAATTAGACTGAGCAGGG + Intergenic
1004141662 6:13023700-13023722 GTCTATGAGCAGAAAGAGTGCGG + Intronic
1004178734 6:13363317-13363339 CTCTGTAAGCAGAGTGTGCAAGG + Exonic
1008060964 6:46996564-46996586 GTTTATCAGCAGCATGAGAATGG + Intergenic
1009676304 6:66826830-66826852 GTGAATAAGCAGAAGCAGCAGGG - Intergenic
1010837009 6:80600834-80600856 GTCTTTAAGTAAAATAAGCAAGG - Intergenic
1011501939 6:88000177-88000199 CTCTCTTAGCAGAATGAGCTTGG - Intergenic
1013936404 6:115600696-115600718 GAATTTAAGCAGAATGATCAAGG + Intergenic
1014671214 6:124306066-124306088 GTTTATAATCAGAATCTGCAAGG + Intronic
1015549234 6:134394776-134394798 GTCCAAAACCACAATGAGCAGGG - Intergenic
1018511028 6:164525161-164525183 GTTTATTAGCAGTATGAGAATGG + Intergenic
1020802769 7:12751971-12751993 GTATATAAGCAGAATAAATACGG + Intergenic
1020936490 7:14472497-14472519 GTCTATCAGCAGCATGAAAACGG + Intronic
1021544360 7:21796420-21796442 GACTGGAAGCAGAATGAACATGG + Intronic
1022127894 7:27375620-27375642 GCCATTCAGCAGAATGAGCAAGG - Intergenic
1022700606 7:32755871-32755893 GACCATAAGCATCATGAGCAAGG + Intergenic
1023225787 7:37967427-37967449 GACTAAATGCAGAATGAGAATGG - Intronic
1024525969 7:50349656-50349678 GTCTATAAGCTGAGTGGGCATGG + Intronic
1024533154 7:50409724-50409746 GTCAAAAAGCAGAAAAAGCAAGG - Intergenic
1026338176 7:69412633-69412655 GTCCATGAGCAGAATGAACTTGG - Intergenic
1027681296 7:81224127-81224149 GTCTATCAGCAGCATGAAAATGG + Intergenic
1029832091 7:103272323-103272345 GACCATAAGCATCATGAGCAAGG + Intergenic
1030563399 7:111120212-111120234 CTCTATTAGCAGCATGAGAACGG - Intronic
1030995363 7:116352903-116352925 GTCAAGAAGTAGAAGGAGCATGG - Intronic
1031867080 7:127049606-127049628 GGCTATAAGCTTAATGAGGATGG - Intronic
1032992407 7:137408377-137408399 GGCTATAAGCAGAAATAGCTTGG + Intronic
1037245295 8:16827744-16827766 GTCTGCAAGCTGAAGGAGCAAGG + Intergenic
1042534004 8:69840778-69840800 TTCAATAAGCAGAAGCAGCAAGG - Intergenic
1042776031 8:72432408-72432430 CTCTATTAGCAGCATGAGAATGG - Intergenic
1045425420 8:102061181-102061203 GACCATCTGCAGAATGAGCAGGG + Intronic
1051346174 9:16153049-16153071 GGTAACAAGCAGAATGAGCAGGG + Intergenic
1051932922 9:22408265-22408287 GACTATAATCAGACTGGGCATGG + Intergenic
1053780176 9:41599166-41599188 GTCTATCAGCAGCATGAAAATGG + Intergenic
1053802616 9:41773947-41773969 GTCTATCAGCAAAAAGAGAAGGG + Intergenic
1054142622 9:61541123-61541145 GTCTATCAGCAAAAAGAGAAGGG - Intergenic
1054168118 9:61809323-61809345 GTCTATCAGCAGCATGAAAATGG + Intergenic
1054190922 9:61985293-61985315 GTCTATCAGCAAAAAGAGAAGGG + Intergenic
1054647447 9:67602424-67602446 GTCTATCAGCAAAAAGAGAAGGG - Intergenic
1054669412 9:67771495-67771517 GTCTATCAGCAGCATGAAAATGG - Intergenic
1054744124 9:68837011-68837033 GTCAATAAGCAGGAAGGGCATGG - Intronic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1057306553 9:93915794-93915816 GTCTCTAGGCTGAAAGAGCATGG - Intergenic
1057853342 9:98582372-98582394 GCCAATAACCAGAATGAGCCTGG + Intronic
1062214459 9:135381612-135381634 CTCTATTAGCAGCATGAGAACGG + Intergenic
1185532880 X:835728-835750 GTATATGTGCAGAATGTGCAGGG + Intergenic
1186057965 X:5671602-5671624 CTTTATTAGCAGAATGAGAATGG - Intergenic
1186109367 X:6239678-6239700 GTTTATTAGCAGCATGAGAATGG - Intergenic
1186567075 X:10674632-10674654 CTTTATAACCAGAATGAGCATGG + Intronic
1186642994 X:11476177-11476199 AGCTATAAGTAGATTGAGCATGG + Intronic
1187301061 X:18050308-18050330 GTCTATTAGCAGCGTGAGAAGGG + Intergenic
1187960417 X:24562313-24562335 CTCTATCAGCAGCATGAGCGAGG - Exonic
1188054689 X:25527528-25527550 CTTTATTAGCAGAATGAGAACGG - Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1195656142 X:107333177-107333199 GTCTATCAGCAGCATGAAAATGG + Intergenic
1200764049 Y:7065455-7065477 CTCTATTAGCAGTATGAGAACGG + Intronic
1201589879 Y:15603391-15603413 CTTTATTAGCAGAATGAGAATGG - Intergenic