ID: 1178334774

View in Genome Browser
Species Human (GRCh38)
Location 21:31732959-31732981
Sequence GAGAAAGATGCGCCTCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178334767_1178334774 17 Left 1178334767 21:31732919-31732941 CCAAAGCATGCTTAGTGTTAGGG No data
Right 1178334774 21:31732959-31732981 GAGAAAGATGCGCCTCCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178334774 Original CRISPR GAGAAAGATGCGCCTCCGAC AGG Intergenic
No off target data available for this crispr