ID: 1178343315

View in Genome Browser
Species Human (GRCh38)
Location 21:31804507-31804529
Sequence CTTTCTTTCAAGACAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178343314_1178343315 19 Left 1178343314 21:31804465-31804487 CCTTCTCTCTCTCTCTCTCTCTT 0: 147
1: 2266
2: 5621
3: 12827
4: 29583
Right 1178343315 21:31804507-31804529 CTTTCTTTCAAGACAGAGTCTGG No data
1178343313_1178343315 23 Left 1178343313 21:31804461-31804483 CCTTCCTTCTCTCTCTCTCTCTC 0: 122
1: 872
2: 4662
3: 11689
4: 27842
Right 1178343315 21:31804507-31804529 CTTTCTTTCAAGACAGAGTCTGG No data
1178343312_1178343315 27 Left 1178343312 21:31804457-31804479 CCTTCCTTCCTTCTCTCTCTCTC 0: 168
1: 562
2: 2407
3: 9453
4: 27917
Right 1178343315 21:31804507-31804529 CTTTCTTTCAAGACAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178343315 Original CRISPR CTTTCTTTCAAGACAGAGTC TGG Intergenic
No off target data available for this crispr