ID: 1178347910

View in Genome Browser
Species Human (GRCh38)
Location 21:31847906-31847928
Sequence CTGAGCTCTTCAGCTCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178347910_1178347917 5 Left 1178347910 21:31847906-31847928 CCCCCGGGAGCTGAAGAGCTCAG No data
Right 1178347917 21:31847934-31847956 GAGCCAGATTGTATAAGACGGGG No data
1178347910_1178347916 4 Left 1178347910 21:31847906-31847928 CCCCCGGGAGCTGAAGAGCTCAG No data
Right 1178347916 21:31847933-31847955 AGAGCCAGATTGTATAAGACGGG No data
1178347910_1178347919 22 Left 1178347910 21:31847906-31847928 CCCCCGGGAGCTGAAGAGCTCAG No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data
1178347910_1178347915 3 Left 1178347910 21:31847906-31847928 CCCCCGGGAGCTGAAGAGCTCAG No data
Right 1178347915 21:31847932-31847954 CAGAGCCAGATTGTATAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178347910 Original CRISPR CTGAGCTCTTCAGCTCCCGG GGG (reversed) Intergenic