ID: 1178347916

View in Genome Browser
Species Human (GRCh38)
Location 21:31847933-31847955
Sequence AGAGCCAGATTGTATAAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178347910_1178347916 4 Left 1178347910 21:31847906-31847928 CCCCCGGGAGCTGAAGAGCTCAG No data
Right 1178347916 21:31847933-31847955 AGAGCCAGATTGTATAAGACGGG No data
1178347909_1178347916 5 Left 1178347909 21:31847905-31847927 CCCCCCGGGAGCTGAAGAGCTCA No data
Right 1178347916 21:31847933-31847955 AGAGCCAGATTGTATAAGACGGG No data
1178347912_1178347916 2 Left 1178347912 21:31847908-31847930 CCCGGGAGCTGAAGAGCTCAGTT No data
Right 1178347916 21:31847933-31847955 AGAGCCAGATTGTATAAGACGGG No data
1178347913_1178347916 1 Left 1178347913 21:31847909-31847931 CCGGGAGCTGAAGAGCTCAGTTC No data
Right 1178347916 21:31847933-31847955 AGAGCCAGATTGTATAAGACGGG No data
1178347911_1178347916 3 Left 1178347911 21:31847907-31847929 CCCCGGGAGCTGAAGAGCTCAGT No data
Right 1178347916 21:31847933-31847955 AGAGCCAGATTGTATAAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178347916 Original CRISPR AGAGCCAGATTGTATAAGAC GGG Intergenic
No off target data available for this crispr