ID: 1178347919

View in Genome Browser
Species Human (GRCh38)
Location 21:31847951-31847973
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178347910_1178347919 22 Left 1178347910 21:31847906-31847928 CCCCCGGGAGCTGAAGAGCTCAG No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data
1178347913_1178347919 19 Left 1178347913 21:31847909-31847931 CCGGGAGCTGAAGAGCTCAGTTC No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data
1178347918_1178347919 -9 Left 1178347918 21:31847937-31847959 CCAGATTGTATAAGACGGGGCTT No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data
1178347914_1178347919 -3 Left 1178347914 21:31847931-31847953 CCAGAGCCAGATTGTATAAGACG No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data
1178347911_1178347919 21 Left 1178347911 21:31847907-31847929 CCCCGGGAGCTGAAGAGCTCAGT No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data
1178347912_1178347919 20 Left 1178347912 21:31847908-31847930 CCCGGGAGCTGAAGAGCTCAGTT No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data
1178347909_1178347919 23 Left 1178347909 21:31847905-31847927 CCCCCCGGGAGCTGAAGAGCTCA No data
Right 1178347919 21:31847951-31847973 ACGGGGCTTCAAAACTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178347919 Original CRISPR ACGGGGCTTCAAAACTAATC TGG Intergenic