ID: 1178349041

View in Genome Browser
Species Human (GRCh38)
Location 21:31858331-31858353
Sequence CTGAGTCCCTTAAGAATGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178349041_1178349049 17 Left 1178349041 21:31858331-31858353 CCCGTCATTCTTAAGGGACTCAG No data
Right 1178349049 21:31858371-31858393 AGTTGATTCCTGTTGATGATGGG No data
1178349041_1178349048 16 Left 1178349041 21:31858331-31858353 CCCGTCATTCTTAAGGGACTCAG No data
Right 1178349048 21:31858370-31858392 AAGTTGATTCCTGTTGATGATGG No data
1178349041_1178349045 -7 Left 1178349041 21:31858331-31858353 CCCGTCATTCTTAAGGGACTCAG No data
Right 1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178349041 Original CRISPR CTGAGTCCCTTAAGAATGAC GGG (reversed) Intergenic