ID: 1178349045

View in Genome Browser
Species Human (GRCh38)
Location 21:31858347-31858369
Sequence GACTCAGAAGTCCCTTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178349042_1178349045 -8 Left 1178349042 21:31858332-31858354 CCGTCATTCTTAAGGGACTCAGA No data
Right 1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG No data
1178349041_1178349045 -7 Left 1178349041 21:31858331-31858353 CCCGTCATTCTTAAGGGACTCAG No data
Right 1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178349045 Original CRISPR GACTCAGAAGTCCCTTGGGA AGG Intergenic
No off target data available for this crispr