ID: 1178349048 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:31858370-31858392 |
| Sequence | AAGTTGATTCCTGTTGATGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1178349041_1178349048 | 16 | Left | 1178349041 | 21:31858331-31858353 | CCCGTCATTCTTAAGGGACTCAG | No data | ||
| Right | 1178349048 | 21:31858370-31858392 | AAGTTGATTCCTGTTGATGATGG | No data | ||||
| 1178349042_1178349048 | 15 | Left | 1178349042 | 21:31858332-31858354 | CCGTCATTCTTAAGGGACTCAGA | No data | ||
| Right | 1178349048 | 21:31858370-31858392 | AAGTTGATTCCTGTTGATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1178349048 | Original CRISPR | AAGTTGATTCCTGTTGATGA TGG | Intergenic | ||