ID: 1178349048

View in Genome Browser
Species Human (GRCh38)
Location 21:31858370-31858392
Sequence AAGTTGATTCCTGTTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178349041_1178349048 16 Left 1178349041 21:31858331-31858353 CCCGTCATTCTTAAGGGACTCAG No data
Right 1178349048 21:31858370-31858392 AAGTTGATTCCTGTTGATGATGG No data
1178349042_1178349048 15 Left 1178349042 21:31858332-31858354 CCGTCATTCTTAAGGGACTCAGA No data
Right 1178349048 21:31858370-31858392 AAGTTGATTCCTGTTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178349048 Original CRISPR AAGTTGATTCCTGTTGATGA TGG Intergenic