ID: 1178349049

View in Genome Browser
Species Human (GRCh38)
Location 21:31858371-31858393
Sequence AGTTGATTCCTGTTGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178349042_1178349049 16 Left 1178349042 21:31858332-31858354 CCGTCATTCTTAAGGGACTCAGA No data
Right 1178349049 21:31858371-31858393 AGTTGATTCCTGTTGATGATGGG No data
1178349041_1178349049 17 Left 1178349041 21:31858331-31858353 CCCGTCATTCTTAAGGGACTCAG No data
Right 1178349049 21:31858371-31858393 AGTTGATTCCTGTTGATGATGGG No data
1178349046_1178349049 -10 Left 1178349046 21:31858358-31858380 CCCTTGGGAAGGAAGTTGATTCC No data
Right 1178349049 21:31858371-31858393 AGTTGATTCCTGTTGATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178349049 Original CRISPR AGTTGATTCCTGTTGATGAT GGG Intergenic