ID: 1178349049 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:31858371-31858393 |
Sequence | AGTTGATTCCTGTTGATGAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1178349042_1178349049 | 16 | Left | 1178349042 | 21:31858332-31858354 | CCGTCATTCTTAAGGGACTCAGA | No data | ||
Right | 1178349049 | 21:31858371-31858393 | AGTTGATTCCTGTTGATGATGGG | No data | ||||
1178349041_1178349049 | 17 | Left | 1178349041 | 21:31858331-31858353 | CCCGTCATTCTTAAGGGACTCAG | No data | ||
Right | 1178349049 | 21:31858371-31858393 | AGTTGATTCCTGTTGATGATGGG | No data | ||||
1178349046_1178349049 | -10 | Left | 1178349046 | 21:31858358-31858380 | CCCTTGGGAAGGAAGTTGATTCC | No data | ||
Right | 1178349049 | 21:31858371-31858393 | AGTTGATTCCTGTTGATGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1178349049 | Original CRISPR | AGTTGATTCCTGTTGATGAT GGG | Intergenic | ||