ID: 1178349281

View in Genome Browser
Species Human (GRCh38)
Location 21:31860728-31860750
Sequence ATTAGCGCCCTTTCTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178349281_1178349288 -10 Left 1178349281 21:31860728-31860750 CCCAGCCCAGAAAGGGCGCTAAT No data
Right 1178349288 21:31860741-31860763 GGGCGCTAATCTATTCATGGGGG No data
1178349281_1178349289 5 Left 1178349281 21:31860728-31860750 CCCAGCCCAGAAAGGGCGCTAAT No data
Right 1178349289 21:31860756-31860778 CATGGGGGATCTACCCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178349281 Original CRISPR ATTAGCGCCCTTTCTGGGCT GGG (reversed) Intergenic