ID: 1178350093

View in Genome Browser
Species Human (GRCh38)
Location 21:31866739-31866761
Sequence ATTTGTGTTGAGCACTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178350091_1178350093 10 Left 1178350091 21:31866706-31866728 CCTGTGAATTACAAATTTAGTCA No data
Right 1178350093 21:31866739-31866761 ATTTGTGTTGAGCACTCCCCAGG No data
1178350090_1178350093 11 Left 1178350090 21:31866705-31866727 CCCTGTGAATTACAAATTTAGTC No data
Right 1178350093 21:31866739-31866761 ATTTGTGTTGAGCACTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178350093 Original CRISPR ATTTGTGTTGAGCACTCCCC AGG Intergenic
No off target data available for this crispr