ID: 1178351017

View in Genome Browser
Species Human (GRCh38)
Location 21:31873290-31873312
Sequence GGTCCCGGGGTCCGGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178351017_1178351022 -10 Left 1178351017 21:31873290-31873312 CCAGGCACCCGGACCCCGGGACC 0: 1
1: 0
2: 1
3: 24
4: 298
Right 1178351022 21:31873303-31873325 CCCCGGGACCCAGGCGCCGCCGG 0: 1
1: 0
2: 2
3: 37
4: 270
1178351017_1178351032 20 Left 1178351017 21:31873290-31873312 CCAGGCACCCGGACCCCGGGACC 0: 1
1: 0
2: 1
3: 24
4: 298
Right 1178351032 21:31873333-31873355 CCCACCCCGCGCGCCCGAGCAGG 0: 1
1: 0
2: 0
3: 22
4: 203
1178351017_1178351034 21 Left 1178351017 21:31873290-31873312 CCAGGCACCCGGACCCCGGGACC 0: 1
1: 0
2: 1
3: 24
4: 298
Right 1178351034 21:31873334-31873356 CCACCCCGCGCGCCCGAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178351017 Original CRISPR GGTCCCGGGGTCCGGGTGCC TGG (reversed) Intergenic