ID: 1178353691

View in Genome Browser
Species Human (GRCh38)
Location 21:31892882-31892904
Sequence CCCTTTCTTGGCAGCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178353683_1178353691 4 Left 1178353683 21:31892855-31892877 CCTCTTGCCCACCTCTGCCGCAG 0: 1
1: 0
2: 2
3: 39
4: 325
Right 1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 222
1178353686_1178353691 -7 Left 1178353686 21:31892866-31892888 CCTCTGCCGCAGACCTCCCTTTC 0: 1
1: 0
2: 1
3: 26
4: 293
Right 1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 222
1178353684_1178353691 -3 Left 1178353684 21:31892862-31892884 CCCACCTCTGCCGCAGACCTCCC 0: 1
1: 1
2: 2
3: 30
4: 273
Right 1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 222
1178353681_1178353691 20 Left 1178353681 21:31892839-31892861 CCTGGGATTCCACTTTCCTCTTG 0: 1
1: 0
2: 2
3: 17
4: 254
Right 1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 222
1178353685_1178353691 -4 Left 1178353685 21:31892863-31892885 CCACCTCTGCCGCAGACCTCCCT 0: 1
1: 0
2: 2
3: 40
4: 358
Right 1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 222
1178353682_1178353691 11 Left 1178353682 21:31892848-31892870 CCACTTTCCTCTTGCCCACCTCT 0: 1
1: 1
2: 10
3: 100
4: 839
Right 1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178353691 Original CRISPR CCCTTTCTTGGCAGCTTCTG TGG Intronic
900648021 1:3717791-3717813 CCCTGCCCTGGCAGCATCTGGGG - Intronic
902213191 1:14918291-14918313 CTCTTTCTTGGAGGCCTCTGTGG + Intronic
902686186 1:18079227-18079249 CCCTTTGCTGGCAGATTCTGGGG - Intergenic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
905980435 1:42220831-42220853 CAATTTCTTGTCTGCTTCTGAGG + Intronic
909044498 1:70692485-70692507 CCTTTTCTTGCCTGTTTCTGAGG - Intergenic
909309654 1:74130081-74130103 CCCTCCCTTGGCTGCTTCTCTGG + Intronic
910535424 1:88292249-88292271 GCTTTTTTTGGCAGCTTCTGCGG - Intergenic
911850977 1:102819973-102819995 TCCTTTCTTTGCTGCTTCTCTGG + Intergenic
913180615 1:116317583-116317605 CCCTTCCTTGCCAGCTTCACTGG - Intergenic
913586125 1:120277486-120277508 CCCTTTCCTGGAAGCTCTTGGGG + Intergenic
913622061 1:120620883-120620905 CCCTTTCCTGGAAGCTCTTGGGG - Intergenic
914459710 1:147872150-147872172 CCCTTTGCTGGCAGCATCAGGGG - Intergenic
914568134 1:148889344-148889366 CCCTTTCCTGGAAGCTCTTGGGG + Intronic
914604690 1:149240905-149240927 CCCTTTCCTGGAAGCTCTTGGGG - Intergenic
915002920 1:152609838-152609860 TCCTCTGTTGGCAGGTTCTGCGG + Intergenic
915269183 1:154741345-154741367 CCTTTCCTTGGTACCTTCTGAGG + Intronic
915872940 1:159580996-159581018 CTCTTTCTTCTCAGCTTCTGGGG + Intergenic
916785728 1:168085780-168085802 CGAGTTCTTGGCAGCTTCTGAGG + Exonic
917441623 1:175073804-175073826 TCCTTTGTGGGGAGCTTCTGTGG + Intronic
918093804 1:181318340-181318362 CCGTTCCTTTGCAACTTCTGTGG + Intergenic
920856364 1:209665833-209665855 CCCCTTCCTGGCATATTCTGGGG - Intergenic
921986048 1:221313517-221313539 CCTTTTCTTTGCAGCCTCTCCGG + Intergenic
923097836 1:230789532-230789554 CCATTTCTAACCAGCTTCTGGGG + Intronic
923284831 1:232483671-232483693 AGCTTTCTAGGCTGCTTCTGGGG + Intronic
923427132 1:233882213-233882235 TACTTTCTTGGAAGCTTCTATGG + Intergenic
924796283 1:247294796-247294818 CCCTTTCTTGCAAGCCGCTGTGG - Intergenic
1064493699 10:15885946-15885968 GCCTTTATTGACAGCTTCTTTGG - Intergenic
1064589076 10:16869749-16869771 CCCCTTCTTGGCAAATTCTGCGG - Exonic
1067048509 10:42999237-42999259 ACCTTTCTCGGGAGCTTCTCAGG + Intergenic
1069026668 10:63549960-63549982 CCCTTGCTGGCCAGCCTCTGTGG - Intronic
1070842017 10:79493984-79494006 TCCTCTCCTGGCAGCTTCTGTGG + Intergenic
1071113202 10:82186803-82186825 CCCTTTCGTAGAAGATTCTGAGG + Intronic
1072372726 10:94781103-94781125 GTGTTTCTTGGCAGCTTCTGTGG - Intronic
1072387697 10:94948384-94948406 GTGTTTCTTGGCAGCTTCTATGG - Intronic
1072537352 10:96373703-96373725 CCCATTCTGGGCCGTTTCTGCGG - Exonic
1074098821 10:110336952-110336974 CTCTCTCTTGACACCTTCTGAGG - Intergenic
1074571217 10:114626198-114626220 CTTGTTCTTGGCAGCTCCTGAGG - Intronic
1075554606 10:123421373-123421395 CCCTTCCTTTCCAGCGTCTGGGG + Intergenic
1078738579 11:14045036-14045058 CCATTTCTTGGCATCTACTGTGG - Intronic
1079048941 11:17136021-17136043 CCCTAACTTGGCTGCTTCTGAGG + Intronic
1080319494 11:30990035-30990057 TTCTTTCTTGGCAGGTTTTGGGG - Intronic
1080859647 11:36142143-36142165 CCCATCCTTAGCAGCCTCTGTGG + Intronic
1082895267 11:58183495-58183517 CCCTTCTTTGACAGCTCCTGAGG - Intergenic
1085083229 11:73650288-73650310 CCATTACTTGGAAGCTTCTAAGG - Intronic
1087256660 11:95963663-95963685 ACCTTTCTTGGCAGTTTTTATGG - Intergenic
1089527409 11:119106550-119106572 CCATTTCTTGGGAGCTTGTTGGG + Intronic
1090656459 11:128849708-128849730 CTTTTTTTTGGAAGCTTCTGTGG + Intronic
1090957983 11:131530661-131530683 CCCTTTCTTGGCTGCATCAAAGG - Intronic
1091021802 11:132106512-132106534 CCTGTTCTTGGCAGCTCCTTTGG - Intronic
1096491702 12:52016169-52016191 GCCTTTCTTCCCAGCTTCTGAGG + Intergenic
1096617063 12:52839364-52839386 GCGTTTCTTGGCAGCCTCGGTGG - Exonic
1096863557 12:54547852-54547874 CCATTTCTTGGCTGGGTCTGGGG + Exonic
1097158256 12:57028202-57028224 CCCTGTCTTGGCAGAAACTGGGG - Intronic
1098292437 12:68969269-68969291 ACCTTGCGTGCCAGCTTCTGCGG + Intronic
1098787889 12:74782243-74782265 TCCTTTCTTGGCAACCTCTAGGG - Intergenic
1100227398 12:92573191-92573213 CTCTCTCTTGGCAGGTTGTGGGG - Intergenic
1100237262 12:92673230-92673252 CCCTTTCTTGGGAGATTCACAGG - Intergenic
1101860586 12:108479311-108479333 CCCTTTCTTGGCTACTTTTGTGG - Intergenic
1103209881 12:119158126-119158148 CCCGTTCTTAGCGCCTTCTGTGG - Exonic
1107140251 13:36991088-36991110 ACCTTTTTAGCCAGCTTCTGAGG + Intronic
1108212018 13:48148698-48148720 CCCTTCCATGGCAGGCTCTGAGG - Intergenic
1108321018 13:49290583-49290605 CCCTTTCTTCCCATCTTTTGAGG - Intronic
1108738881 13:53314218-53314240 CCCTTTCTTGGCAGCTGTGAGGG + Intergenic
1109502163 13:63252176-63252198 CTCTTTGTTAGCACCTTCTGTGG + Intergenic
1113604731 13:111597240-111597262 CCCTTTGTTGGCCGTCTCTGGGG + Intronic
1113760935 13:112846094-112846116 CCCTTTTCTGGCTGCTTTTGAGG + Intronic
1118317001 14:64731604-64731626 CCCCTTCTTGTCTGCTTCTTGGG + Intronic
1118839997 14:69502710-69502732 CCCTTCCTTGGGAGATGCTGGGG + Intronic
1119636488 14:76277696-76277718 CCCTTTCTTAGGAGCTTCCTTGG + Intergenic
1121218400 14:92266156-92266178 CCTGTGCTTGGCAGCTTCCGCGG + Intergenic
1121922909 14:97899637-97899659 GCCTTTCATGCCAGCTGCTGAGG - Intergenic
1121923012 14:97900675-97900697 TCCTTTCTCGCCAGCTGCTGAGG - Intergenic
1124251691 15:28110394-28110416 CCTTTTGTTGTCAGCTTTTGCGG - Intergenic
1126175612 15:45732809-45732831 CCCTTTCCTCCCAGCCTCTGGGG - Intergenic
1127366918 15:58299799-58299821 GCCTTTCTAAGCAACTTCTGTGG - Intronic
1127743503 15:61938439-61938461 CCCTTTCTTGGCTGCATCCCAGG + Intronic
1129951313 15:79594050-79594072 CCCTTTCTATGCTGCCTCTGGGG - Intergenic
1132664917 16:1077151-1077173 GCCTTTCCTGGCAGCTGCTGGGG + Intergenic
1132939945 16:2501565-2501587 ACCCTTCTTGGCTGCCTCTGAGG + Exonic
1133268112 16:4596852-4596874 CCCTGTCTCTTCAGCTTCTGGGG + Intronic
1136500476 16:30667564-30667586 CCCTTTCACGGCAGCTCCCGGGG + Exonic
1138157613 16:54720666-54720688 CCTTTCCTTGGCCACTTCTGGGG - Intergenic
1139287109 16:65825582-65825604 CCTTTACTTTGCAGCTTCTCCGG - Intergenic
1139824313 16:69745157-69745179 CCCTTTGCTGACAGCTTCAGTGG - Intronic
1140047479 16:71451560-71451582 CCCTTTCTTGCCACCATGTGAGG + Intronic
1141263316 16:82473441-82473463 GCATTTCTTGGCAACATCTGTGG - Intergenic
1141601716 16:85130774-85130796 TCCTCTCTGGGCAGTTTCTGGGG + Intergenic
1141605469 16:85150560-85150582 CCCCATCTTGGCTGCTTCTTGGG - Intergenic
1142183892 16:88685516-88685538 ACCTGGCTTGGCAGCTTCTTGGG - Intronic
1143396735 17:6605288-6605310 CTCTTTCTGGTCAGCTACTGTGG - Intronic
1143680249 17:8470884-8470906 GCCTTTCTTGGCAGCTGCCCCGG + Intronic
1147112868 17:38276750-38276772 CTTTTTCTTGGCAGCTTTTCTGG - Intergenic
1147170583 17:38616576-38616598 CCCTTGCATGGCAGCTTAAGTGG - Intergenic
1148416752 17:47512497-47512519 CTTTTTCTTGGCAGCTTTTCTGG + Intergenic
1149878727 17:60266353-60266375 CCCTTTCTTGACAGTTTGTAAGG - Intronic
1152538217 17:80962447-80962469 CCCTCTCTTGGCAGCGTCAATGG + Exonic
1154359381 18:13646350-13646372 TCTTTTCTTGGATGCTTCTGGGG - Exonic
1155680451 18:28480605-28480627 GCATTTATTGTCAGCTTCTGTGG + Intergenic
1155702332 18:28762315-28762337 CCCTTTGCTGGCAGCTTCCCTGG - Intergenic
1157184522 18:45527135-45527157 CCTTTTCTTGGAAGATTCTTGGG - Intronic
1159729155 18:72003380-72003402 CTCTTTATTGGCATCTTATGAGG + Intergenic
1159959024 18:74541258-74541280 GCCTTTCCTGGCAGCTCCTGTGG - Intronic
1160431900 18:78818683-78818705 CCCTTGGTGGGCAGCTTCTTGGG - Intergenic
1161266843 19:3368049-3368071 CCCTTTCTGAGCAGCTTTGGGGG + Intronic
1161441548 19:4294585-4294607 CCCTTTGCTGGCAGCTGCGGCGG + Exonic
1161441850 19:4296450-4296472 CCCTTCTTTTGCAGCCTCTGAGG + Intronic
1163567357 19:18059431-18059453 CCATTTCATGGCAGCATCTAGGG + Exonic
1164670419 19:30069197-30069219 CCCTTGCCTGGCAGCTGGTGAGG - Intergenic
1165317817 19:35067214-35067236 CTCCATCTGGGCAGCTTCTGGGG + Intergenic
1165419706 19:35716858-35716880 CCCTTCCTGGGGCGCTTCTGGGG - Exonic
1165827877 19:38715738-38715760 CCCTTTCTTGGCAATGGCTGGGG - Intronic
1166218638 19:41352166-41352188 CACTTTCCTGGCACCCTCTGGGG + Intronic
1168209545 19:54880571-54880593 CCCTTGCTGGGAAGCTTGTGTGG + Intronic
924966437 2:80833-80855 CCCTTTCTTAGCTGCTAGTGTGG - Intergenic
925913155 2:8586542-8586564 CCCCTGCTTGGGAGCTCCTGGGG - Intergenic
929400093 2:41569758-41569780 CCTTTTCTTGGAAGTTTCTCTGG - Intergenic
929530941 2:42752277-42752299 CCCTTCCTTGGCATGCTCTGAGG + Intronic
930411728 2:51032677-51032699 CCCTTTCCTGGCACCCTCTCAGG - Intergenic
932560418 2:72862843-72862865 TGCTTTCTTGGCGGCTTCTGGGG + Intergenic
936632138 2:114215094-114215116 CCCTTTGTTAGGAGCATCTGGGG - Intergenic
937126658 2:119478910-119478932 GCTTTTCTTGGCAGGTTGTGAGG - Exonic
937259385 2:120575944-120575966 CTCTTGATTGGCAGCTTGTGGGG - Intergenic
937904856 2:127048151-127048173 TCTTTTCCTGGCAGCTGCTGTGG - Exonic
939382810 2:141457842-141457864 CTGTTTCTTGGGGGCTTCTGGGG + Intronic
940692764 2:156940098-156940120 CCCTTGCTTGAAAGCTTTTGTGG - Intergenic
940962009 2:159797072-159797094 TCCTTTCTTGAAAACTTCTGTGG - Intronic
944822254 2:203442608-203442630 CCCTGTCTTGGCTGCTTCAGGGG + Exonic
944905811 2:204260901-204260923 CCTTTTCTAAGCAGGTTCTGTGG - Intergenic
945406163 2:209451467-209451489 CCCTTTCCTGGCAGTAGCTGTGG + Intronic
946227973 2:218274717-218274739 CCCATTCTTGAAAGCTGCTGGGG - Exonic
946289854 2:218736306-218736328 TGCTTTCATGGCAGCATCTGGGG - Intronic
947830943 2:233141209-233141231 CCATATGTTGGCAGCTTCTTAGG + Intronic
947884283 2:233553058-233553080 CCCTTCCTTCTCAGCTTCTATGG - Intronic
948338463 2:237230168-237230190 CCCTCCATTGGCATCTTCTGTGG - Intergenic
948519168 2:238524665-238524687 CCCTTTCTTGGCAGTTCTTTTGG + Intergenic
1170868537 20:20183087-20183109 CCTTTTTTTGGCAGACTCTGAGG - Intronic
1171155133 20:22865058-22865080 CCATTTCTTGGCAGCTATTTGGG - Intergenic
1172015968 20:31873076-31873098 CCCCTTCTTTCCAGCTTCTCGGG - Intronic
1172869026 20:38123433-38123455 GCCTTTCTTGGAAGCTACTATGG - Intronic
1172874894 20:38158255-38158277 CCCTTTCTTCCCAGATCCTGGGG + Intronic
1177925414 21:27208323-27208345 CCCGATTCTGGCAGCTTCTGGGG + Intergenic
1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG + Intronic
1179626357 21:42651761-42651783 TCCTCTCTAGGCAGCTGCTGAGG + Intergenic
1180246952 21:46554764-46554786 CCTTTTCTGGGCAGCTTGAGAGG + Intronic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1181174579 22:21028425-21028447 CCCTTTCTAGGCAGCCTCCTTGG + Exonic
1181423735 22:22819443-22819465 CCCTTTTCTTGCAGGTTCTGTGG + Intronic
1182008428 22:26980575-26980597 CCTTTCCTTGGCACCTACTGTGG + Intergenic
1184233197 22:43169345-43169367 CGCTGTCTTGCCAGCCTCTGGGG + Intronic
1185016473 22:48346144-48346166 CCCATTCTGGGCAGCGTTTGTGG - Intergenic
951095393 3:18623952-18623974 CCCTTTCCTGGCAGCCCCTAAGG + Intergenic
951788986 3:26458943-26458965 TCCTTTCTTGGCATATTATGTGG + Intergenic
953563712 3:44013743-44013765 CTCTTTCTTGGCAGCTCCGTGGG + Intergenic
954593926 3:51809289-51809311 CCCCTTCTTGGCAGACACTGGGG + Intergenic
954610882 3:51943951-51943973 CCCTGTCTTGGAAGCTTGGGGGG - Intronic
954683867 3:52360107-52360129 CCCCTTCCTGGCAGCTGCTCTGG - Intronic
954809082 3:53236817-53236839 CCCTTCCTTGGCATCTCCTCGGG - Intronic
955548299 3:60055856-60055878 CTCTTTCTAGGCAGCTTCGAAGG + Intronic
956380060 3:68655666-68655688 CCCATTCTTGGCAGCCCATGAGG + Intergenic
956464014 3:69500739-69500761 CCACTTCTGGGCAACTTCTGTGG - Intronic
957193336 3:77038995-77039017 CCCGTCCTTAGCATCTTCTGTGG + Intronic
960876574 3:122301434-122301456 CCCTTTCTTAACAGTTTTTGTGG + Intergenic
963964789 3:151354511-151354533 CACTTGCTTGGCATCTTCTTTGG - Intronic
965277765 3:166708323-166708345 CCTTTGCTTGGCAGCTTTTTAGG - Intergenic
965925340 3:173972046-173972068 CTCTTTCTTGGGGCCTTCTGTGG - Intronic
966212558 3:177468445-177468467 GCCTTTCTTGGCAGCATTAGGGG + Intergenic
966837999 3:184064492-184064514 CCTTTCCTTGGCAGCATCTAGGG + Intergenic
967954798 3:194869819-194869841 CCCTGCCTTGGGAGCTGCTGTGG + Intergenic
968310347 3:197677533-197677555 CTCTTTCTTTTCAGCTGCTGCGG - Exonic
968884981 4:3323982-3324004 CAGTTTATTGGCAGGTTCTGTGG + Intronic
971170544 4:24228700-24228722 CTCATTGTTGGGAGCTTCTGAGG - Intergenic
972769731 4:42186085-42186107 CCCTTCCCTGGCACCTTCAGAGG + Intergenic
975395063 4:73865061-73865083 CATTCTCTTGGCAGCTCCTGTGG + Intergenic
977679279 4:99781124-99781146 CCCTTTAATGGCATATTCTGAGG - Intergenic
977727789 4:100317411-100317433 CCCTCTGTTGGCAGCTTTTCAGG - Intergenic
978945044 4:114485379-114485401 TCCTTGCTAGCCAGCTTCTGTGG - Intergenic
982317428 4:154046009-154046031 CCCTGTGTTGTCAGCTCCTGAGG - Intergenic
983356180 4:166660388-166660410 CTCTTTCTTGCCATATTCTGTGG - Intergenic
984935832 4:184888778-184888800 CCCCTTCCTGGCTGCCTCTGGGG - Intergenic
989104410 5:37847626-37847648 CCCTGTGTTGGCAGTTGCTGAGG + Intergenic
989423353 5:41266933-41266955 CCCTTCCTTGAAAGCTTTTGAGG + Intergenic
992674507 5:79092259-79092281 CCCTTGTTGGGCAACTTCTGGGG + Intronic
994615611 5:102100437-102100459 ACCTTTATTGGGAGTTTCTGTGG + Intergenic
998163478 5:139826953-139826975 CCATTTTCTGGGAGCTTCTGTGG - Intronic
998406149 5:141875949-141875971 CCCTTCCCTGGCAGCTCCCGAGG + Intronic
998600052 5:143576073-143576095 CCCTTTCTTGTTAGCTTAAGGGG + Intergenic
1001756073 5:174171099-174171121 CCCCTTCTTGTCAACCTCTGTGG + Intronic
1003495903 6:6663003-6663025 CCCTTCCCTCGCAGCTTCAGAGG - Intergenic
1005153230 6:22776285-22776307 CCCTTTCTCAGCTGCTTCTTAGG - Intergenic
1005368840 6:25108340-25108362 CTCTTTCTTGGCTCCTCCTGAGG + Intergenic
1006473392 6:34240562-34240584 CCCGCCCTTGGCAGCATCTGGGG + Intronic
1009409160 6:63345805-63345827 CCCATTCTTTGCTGCTTCTGTGG - Intergenic
1010128751 6:72466448-72466470 CATCTCCTTGGCAGCTTCTGTGG + Intergenic
1011627000 6:89290921-89290943 CACATTCTTTGCAGCCTCTGGGG + Intronic
1015521377 6:134134999-134135021 CCCTCTACTTGCAGCTTCTGAGG - Intergenic
1017210798 6:151853597-151853619 CTATTTCTTGGCAGCTTTTGTGG + Intronic
1019303870 7:322995-323017 CCCTCTCCTGGCAGCTGCTCAGG - Intergenic
1020979801 7:15053304-15053326 CCAAGCCTTGGCAGCTTCTGTGG - Intergenic
1021465352 7:20937003-20937025 CACATTCTTGCCAGCTTTTGGGG - Intergenic
1021543167 7:21783167-21783189 TCCATTCCTGGCAGCTTTTGAGG + Intronic
1023089966 7:36608375-36608397 CCCTTCCTTTGCAGGCTCTGTGG + Intronic
1024788479 7:52934967-52934989 CCCTATCTTTTCAGCTTCTCGGG - Intergenic
1025245105 7:57311019-57311041 CCCTTTCTTTACAGATGCTGCGG + Intergenic
1025263566 7:57438535-57438557 CCCTCGCCTGGCAGCTTCTCAGG + Intergenic
1025607270 7:63048263-63048285 CCCTGTCTTGGCAGACACTGCGG - Intergenic
1029214074 7:98932814-98932836 TCCTTGCTTGGTAGCATCTGAGG + Intronic
1029912030 7:104163344-104163366 CCCTTTAGTGGCAACTTCAGAGG + Intronic
1030151148 7:106406561-106406583 CTCTTTCTTGTCAGTTGCTGTGG - Intergenic
1032464764 7:132136998-132137020 CCCTTTCTTTGCAGCTCCTGTGG - Intronic
1035087736 7:156275706-156275728 CATTTTCTGAGCAGCTTCTGTGG + Intergenic
1036760232 8:11503645-11503667 CTCTTTCTTGGCAAGGTCTGAGG + Intronic
1036777662 8:11624763-11624785 CCCTGTCTTGGCAGACACTGGGG + Intergenic
1036900648 8:12666719-12666741 CCCTGTCTTTCCTGCTTCTGAGG - Intergenic
1037834351 8:22207387-22207409 CCCGTCCTCGGCCGCTTCTGTGG + Exonic
1038002026 8:23400064-23400086 TCCTTTCTTGGCAGATCATGTGG - Intronic
1042339928 8:67667802-67667824 CCCAGTCTTGGCAGCCACTGGGG - Intronic
1042727078 8:71889968-71889990 CCCTTTCAGCCCAGCTTCTGTGG + Intronic
1046339764 8:112838148-112838170 ACCTTCCTTGGCAGTGTCTGGGG - Intronic
1047309617 8:123681107-123681129 TACTTTCTTGGCAGCTTAAGTGG - Exonic
1048603121 8:135940133-135940155 ACCTGTCTTTGCAGATTCTGGGG + Intergenic
1049102632 8:140590377-140590399 CCGTGTTTGGGCAGCTTCTGTGG - Intronic
1049462462 8:142736452-142736474 GCCTCTCCTGGCAGCTTCTCAGG + Exonic
1049707170 8:144048344-144048366 CCCTGTCCTGGGAGCTCCTGAGG + Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1051499406 9:17760731-17760753 CCTTTTCTTATCAGCATCTGTGG - Intronic
1053300684 9:36947168-36947190 CCCCTTCCTGGCAGCTCCAGAGG + Intronic
1055776314 9:79770214-79770236 CCCTTTCTTGGGAAATTATGAGG - Intergenic
1055922289 9:81473614-81473636 CCCATTTTTTGCAGCTTCTTGGG + Intergenic
1057199197 9:93131376-93131398 CGCTTTCCTGGCAGATCCTGAGG - Intronic
1057781972 9:98057223-98057245 CCCCTGCCTGGCACCTTCTGTGG + Intronic
1058683647 9:107462170-107462192 CCCTTTGTGGGGAACTTCTGAGG - Intergenic
1059253903 9:112911420-112911442 ACCTTTCTTTGCATCTCCTGGGG + Intergenic
1061781648 9:132999775-132999797 CCCTTTCCTGGAAGGTCCTGGGG + Intergenic
1062264734 9:135681797-135681819 CTCTTCCCTGGCAGCCTCTGAGG - Intergenic
1062374318 9:136255123-136255145 CCCTCTCTTAGCAGCTCCTGTGG - Intergenic
1188432532 X:30121097-30121119 CCCTTACTTTCCAGCTGCTGTGG + Intergenic
1189397495 X:40635954-40635976 CCCTTTCTTGACTGCTTTTTGGG + Intronic
1189712951 X:43833530-43833552 CCCTGTCTTTGCAGCTCCTTTGG + Intronic
1190291855 X:48998421-48998443 TCCTTTCTTGGAAGCTCTTGAGG + Intronic
1191805244 X:65129123-65129145 CCCTTTCTTGCCTTCTTGTGTGG + Intergenic
1192151216 X:68713618-68713640 CCCTTTCCTGGCTGCCTCTCTGG + Intronic
1192594604 X:72393586-72393608 CCCTTTTGTGACAGCTTCTTTGG + Intronic
1193425712 X:81338289-81338311 CCCTTTCTTGGGTGTGTCTGAGG + Intergenic