ID: 1178353997

View in Genome Browser
Species Human (GRCh38)
Location 21:31895384-31895406
Sequence GTGTTGATTACTTATCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178353993_1178353997 12 Left 1178353993 21:31895349-31895371 CCAGTCTGCAAATTCGAAGAGAA 0: 1
1: 0
2: 2
3: 7
4: 113
Right 1178353997 21:31895384-31895406 GTGTTGATTACTTATCAGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178353997 Original CRISPR GTGTTGATTACTTATCAGCC CGG Intronic
901779800 1:11586366-11586388 TTGTTGCTTAGCTATCAGCCTGG - Intergenic
907218007 1:52882892-52882914 TTGTTGAGTACTTATCAGTCAGG + Intronic
907612056 1:55881226-55881248 GTGTTCATTGCTTATCAGATTGG + Intergenic
913976615 1:143462990-143463012 GTGTTGATTCTTTCTTAGCCAGG - Intergenic
914071016 1:144288607-144288629 GTGTTGATTCTTTCTTAGCCAGG - Intergenic
914108139 1:144677748-144677770 GTGTTGATTCTTTCTTAGCCAGG + Intergenic
919772835 1:201173673-201173695 GTGTTGACAACTTATAAGGCCGG + Intergenic
923870796 1:237992057-237992079 GAGTTGTTTACTTTTCACCCAGG - Intergenic
1063013485 10:2049918-2049940 CTGTTCATAACTTATCAACCAGG + Intergenic
1063157502 10:3393816-3393838 GTGTTGATGACTTGTCTGTCTGG + Intergenic
1066564419 10:36706201-36706223 GTGTTGATTACTGAACAGCAGGG + Intergenic
1076229032 10:128804667-128804689 CTGTGGATTACCTAGCAGCCAGG + Intergenic
1079705585 11:23613341-23613363 ATGTTGTTTACTTCTTAGCCAGG + Intergenic
1085819955 11:79781662-79781684 GTCTGCATTACTTAACAGCCTGG - Intergenic
1093431087 12:19085619-19085641 GTGGTGGCTACTTGTCAGCCTGG - Intergenic
1098296913 12:69013146-69013168 GAGTTGATTATTTAAGAGCCTGG + Intergenic
1100959838 12:99950318-99950340 GTCTTGATAATTTATCAGTCAGG - Intronic
1105222618 13:18346829-18346851 GTGTTGATTCTTTCTTAGCCAGG + Intergenic
1130894415 15:88159140-88159162 CTGTTCATTACTTTTTAGCCAGG + Intronic
1149513482 17:57261677-57261699 GTGTTGTTTAGTTATCATCAGGG + Intronic
1150625113 17:66836393-66836415 GTCTTGATCAATTAACAGCCAGG + Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
926331891 2:11832475-11832497 GTGGTGCTTTCTGATCAGCCTGG - Intergenic
926363035 2:12108007-12108029 GTGTGGATTACGTGTCGGCCAGG - Intergenic
926399231 2:12478988-12479010 GTTTTCTTTACTTATGAGCCAGG - Intergenic
928307866 2:30185780-30185802 GTGTTGATTAGATTTCAGGCAGG + Intergenic
931058205 2:58496452-58496474 GTGTGGATTCCCTATCTGCCTGG + Intergenic
934291620 2:91698195-91698217 GTGTTGATTCTTTCTTAGCCAGG - Intergenic
935190705 2:100776460-100776482 GTATAGATTACTCATCACCCAGG + Intergenic
938101160 2:128499041-128499063 GTGTAGGATAGTTATCAGCCGGG + Intergenic
938225393 2:129611530-129611552 GTGATGATTACCCATCACCCTGG + Intergenic
943069996 2:183129575-183129597 ATATTGATTGCTTATGAGCCTGG + Intronic
946679369 2:222196762-222196784 GTGCAGATTACTAAACAGCCAGG + Intergenic
948649728 2:239433996-239434018 GTCTTGTTTACTTATCTGTCTGG + Intergenic
1172519537 20:35557907-35557929 GGGTTGATCACTCATGAGCCTGG - Intergenic
1175916846 20:62430027-62430049 CTGTTGAATCCTGATCAGCCAGG + Intergenic
1176731166 21:10499253-10499275 GTGTTGATTCTTTCTTAGCCAGG + Intergenic
1178353997 21:31895384-31895406 GTGTTGATTACTTATCAGCCCGG + Intronic
1178816432 21:35934256-35934278 GTGCTGATTATTTCTCAGCTAGG - Intronic
1179040761 21:37800508-37800530 GTGTTGATTATTTCTCATCTGGG + Intronic
1181882436 22:25991759-25991781 GTGTTGAGTATTTTGCAGCCAGG - Intronic
949566826 3:5252983-5253005 GATTTGATTACTCATCAGCACGG + Intergenic
949752297 3:7368142-7368164 GTGTGGACTTCTTATCTGCCCGG + Intronic
951144055 3:19205470-19205492 TTATTGAATACTTATAAGCCAGG + Intronic
953496391 3:43390845-43390867 GTTCTGATTACTGATCAGCAAGG - Intronic
954629189 3:52039066-52039088 GTGTTGATAACTCATCACCCAGG - Intergenic
955913530 3:63882707-63882729 GTGTTGTTTATTTATCAGACAGG + Intronic
956462789 3:69488220-69488242 GTGTTGTTTACTTATAGGACTGG - Intronic
956911182 3:73819087-73819109 GTTTTTTTTACTTATCAGGCAGG - Intergenic
958764191 3:98345058-98345080 GTTTTAATTATTTATCGGCCAGG + Intergenic
962202360 3:133412491-133412513 GTATTGATTAGTTCTCAGCAAGG + Intronic
962553423 3:136521198-136521220 ATGTTAATTACTTACCAGCCAGG + Exonic
963691536 3:148509229-148509251 TTCTTGAATACTTATCAGACTGG - Intergenic
964624228 3:158743937-158743959 GTGTTGTCTATTTATTAGCCAGG - Intronic
966584840 3:181611004-181611026 GTGTTGCTTACTCTTTAGCCTGG + Intergenic
967130502 3:186466017-186466039 GTGTTGATTCTGTATCAGTCAGG - Intergenic
969393061 4:6903448-6903470 GTGTTGATTCCTTAACCTCCTGG + Intergenic
969454532 4:7293855-7293877 TTGGTGATAACTTTTCAGCCAGG + Intronic
970657553 4:18248212-18248234 GTGTTAATGACTCATCAGCAGGG + Intergenic
975037231 4:69699115-69699137 GTGCTGATTACTTCTCAGCTGGG + Intergenic
982914546 4:161189600-161189622 GTGTTTATGACTAATCAGTCGGG - Intergenic
983136168 4:164083441-164083463 ATGTTGCTTCCTTATGAGCCAGG - Intronic
993661475 5:90642113-90642135 GTGTTTATTTTTTATCAGCGTGG + Intronic
1000867135 5:166527452-166527474 AGGTTGATTTCTTCTCAGCCTGG - Intergenic
1004815670 6:19309592-19309614 GTGTTGATGACTGATCATGCTGG + Intergenic
1011845986 6:91562957-91562979 GTGCTGATTTCTTATCATCTGGG - Intergenic
1016771747 6:147859645-147859667 TTATTGATTACTTATCACCCTGG - Intergenic
1016815036 6:148295584-148295606 CTTTTGATTACTGATCAACCGGG + Intronic
1017334141 6:153235584-153235606 GTTTTGAGTACTTATTAACCAGG + Intergenic
1018130877 6:160731679-160731701 GTATTGATTCCATATCATCCTGG + Intronic
1018563414 6:165125892-165125914 TTGTTAATTACTATTCAGCCAGG + Intergenic
1022301990 7:29110418-29110440 GTGTTGGTCACTTTTCAGCCAGG + Intronic
1041467862 8:58175375-58175397 GTGTTGGTTACATCTAAGCCTGG + Intronic
1046992452 8:120474205-120474227 TTGTTGATTACTGATTAGGCTGG + Intronic
1050340345 9:4631048-4631070 GTGTGGATTCCTTACCAGCAGGG - Intronic
1053565283 9:39243029-39243051 GTGCTGACTACTTTTCAACCTGG + Intronic
1054131868 9:61376010-61376032 GTGCTGACTACTTTTCAACCTGG - Intergenic
1057495706 9:95559487-95559509 GTGTTGCCCACTTAGCAGCCTGG - Intergenic
1058261737 9:102841651-102841673 GGCTTGGTTACTTATTAGCCTGG - Intergenic
1058597231 9:106628461-106628483 GTGTTGATTACTGATAAGGAAGG + Intergenic
1059866069 9:118515083-118515105 GGGTTGATAAATTAGCAGCCAGG + Intergenic
1188403566 X:29778515-29778537 TTGTTGATCACTTATGTGCCAGG - Intronic
1194087390 X:89545714-89545736 TATTTGATTAATTATCAGCCTGG - Intergenic
1199053533 X:143265514-143265536 GTGTTGACTGCATATCATCCTGG + Intergenic
1200440039 Y:3201586-3201608 TATTTGATTAATTATCAGCCTGG - Intergenic