ID: 1178363663

View in Genome Browser
Species Human (GRCh38)
Location 21:31970401-31970423
Sequence CTTAGGTTACCAAGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178363663 Original CRISPR CTTAGGTTACCAAGGGAACC TGG Intronic
902025087 1:13377078-13377100 CTTAGTGTTCCAATGGAACCTGG + Intergenic
903060862 1:20667684-20667706 GTTAGCATACCAAGGGAAGCAGG + Intronic
906760124 1:48369442-48369464 CTTAGGTAAACAAAGGAGCCAGG - Intronic
907807197 1:57832800-57832822 TTTATGTTTCCAAGGGAACAGGG + Intronic
908552945 1:65228084-65228106 CTCAGGTTTGCTAGGGAACCAGG + Exonic
911459332 1:98169655-98169677 CTTATGTTACCAGGGAGACCAGG - Intergenic
913413022 1:118573766-118573788 CTTAGGTAAACAAAGCAACCAGG - Intergenic
913716281 1:121537776-121537798 CTTAGGTAAACAAAGGAGCCAGG - Intergenic
915454537 1:156030828-156030850 CTTGGGCTACCAAGGGAGTCAGG + Intergenic
915910280 1:159910624-159910646 GCTAGGTTGCCAGGGGAACCAGG - Intergenic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
924407487 1:243765611-243765633 GTTTGGTTAACAAGGGAATCAGG - Intronic
1062787447 10:277483-277505 CGTTGGTCACCAAGGGAACCAGG + Exonic
1076339910 10:129738095-129738117 CTTAGGTTAACAACGCAGCCGGG - Intronic
1078052993 11:7983769-7983791 TATATGTTATCAAGGGAACCTGG - Intronic
1079059895 11:17239411-17239433 CTCAGGTCACCAAGTAAACCTGG - Intronic
1080093624 11:28378197-28378219 CTTAGGTAAACAAAGGAGCCAGG - Intergenic
1082158297 11:48853239-48853261 CTTAGGTAAACAAAGGAGCCGGG - Intergenic
1086167241 11:83793639-83793661 CCTAGGTTTCCTAGGTAACCTGG + Intronic
1089063623 11:115645825-115645847 CTTGGGTTACCATGGGAACCAGG + Intergenic
1089698852 11:120232170-120232192 GTGAGGTTGCCCAGGGAACCAGG - Intergenic
1094488012 12:30940203-30940225 CTTAGGTTCCTTGGGGAACCAGG + Intronic
1094567577 12:31613846-31613868 CTCAGGTTTGCTAGGGAACCAGG - Intergenic
1094861330 12:34469707-34469729 ATTAGGTAACCAAAGCAACCAGG - Intergenic
1095534369 12:43228191-43228213 CTTAGGTAAACAAAGGAGCCAGG + Intergenic
1095553372 12:43471436-43471458 CTTAGGTAAACAAAGGAGCCAGG + Intronic
1098388004 12:69939142-69939164 CTTAGGTAAACAAAGCAACCAGG + Intronic
1099266527 12:80454035-80454057 CTTAGGTAAACAAAGCAACCTGG - Intronic
1101195462 12:102377628-102377650 GTTAGGTTACAAAGAGAACAGGG + Intergenic
1102418011 12:112781244-112781266 GTTGGTTTTCCAAGGGAACCAGG - Intronic
1105714785 13:23052377-23052399 CTGAGTTTGCCAAGGGAAACAGG - Intergenic
1107162761 13:37250810-37250832 CTTAGGTAAACAAAGGAGCCAGG + Intergenic
1108490310 13:50975126-50975148 CTTAGGTAACCAGAGGAAGCTGG - Intergenic
1111947014 13:94676693-94676715 CTCAGGATGCCATGGGAACCAGG + Intergenic
1113422309 13:110180308-110180330 CGTAGGTTATCAGGGGAAGCTGG + Intronic
1113448791 13:110390830-110390852 TTTAGGATACCATGGGAACAGGG - Intronic
1115984778 14:39093186-39093208 CTTTTGTTACCAAAGGAATCAGG - Exonic
1125644446 15:41260182-41260204 TTTAGGTAACCACAGGAACCAGG + Intronic
1127031776 15:54872161-54872183 CTTAGGTAACCAAAGCAGCCAGG + Intergenic
1130140801 15:81224816-81224838 GTGAAGTTACCAAGGGGACCAGG + Intronic
1133459808 16:5977526-5977548 CTTCGGTTTCCATGGAAACCAGG + Intergenic
1135729734 16:24883974-24883996 TCTGGGTCACCAAGGGAACCTGG - Intronic
1146251446 17:31348091-31348113 CTCAGGTTTGCTAGGGAACCAGG + Intronic
1150445831 17:65226334-65226356 CTTAGGTTGCCAGGGATACCCGG + Intronic
1151495348 17:74455018-74455040 CTGAGGTTCCCAAGAGAAGCTGG + Intergenic
1158074421 18:53511916-53511938 CTTAGGTAAACAAAGCAACCAGG + Intronic
1158834490 18:61316253-61316275 CTTAGGTAAACAAAGCAACCGGG - Intergenic
1161209547 19:3059084-3059106 CTTAGGATACCCCAGGAACCTGG + Intronic
925205329 2:2000929-2000951 CTGAGCTTCCCAGGGGAACCAGG - Intronic
926862281 2:17321864-17321886 GTGAGGTGACCAAGGGAACTAGG - Intergenic
928959841 2:36912778-36912800 CTTAGGTAACCAAGTGAAGATGG - Intronic
929092505 2:38233465-38233487 CTTAAGTCACATAGGGAACCTGG + Intergenic
929217711 2:39433725-39433747 CTTGGGTTACCTAGGGACCTAGG - Intronic
929587365 2:43125078-43125100 CTCTGGTTATCAAGGGGACCTGG - Intergenic
932162045 2:69469552-69469574 CATTGGTTACCAAAGGAACTGGG - Exonic
935026670 2:99283622-99283644 CTTAAGTCACCAAGAGAGCCAGG - Intronic
936949241 2:117961069-117961091 GGTGGGTTACCAAGTGAACCAGG - Intronic
937564858 2:123272535-123272557 CTTTCCTTATCAAGGGAACCAGG - Intergenic
937993395 2:127675955-127675977 CCCAGGTTTCCAGGGGAACCAGG + Intronic
939159622 2:138571718-138571740 CTTAGGTGACAAAGGGAAACAGG - Exonic
944414953 2:199471237-199471259 CTTAAGTTACCAAGGGATTAGGG - Intronic
944785015 2:203061266-203061288 CTTAGTTTTCAAAGGGAACTGGG + Intronic
948528122 2:238586050-238586072 CTGAGCTGAACAAGGGAACCTGG - Intergenic
1171289962 20:23977259-23977281 CTGAGGTTTCCAAGAGAAGCAGG - Intergenic
1171404547 20:24901066-24901088 CTTAGGTAAACAAAGCAACCAGG + Intergenic
1173962644 20:47086955-47086977 CTTAAACTACCAAGTGAACCAGG + Intronic
1178363663 21:31970401-31970423 CTTAGGTTACCAAGGGAACCTGG + Intronic
1178693884 21:34776091-34776113 CTGTGGTCACCAGGGGAACCAGG - Intergenic
1178736987 21:35161380-35161402 CTTACATTTCAAAGGGAACCTGG - Intronic
1182574386 22:31262984-31263006 CTCAGGTTTCTAAGGAAACCTGG - Intronic
1184885012 22:47338333-47338355 CACAGGTTGCCAAGGGAGCCTGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950919228 3:16677080-16677102 CTTAGGTAAACAAAGCAACCGGG + Intergenic
955398560 3:58574779-58574801 CTTGGGTCACCAACAGAACCAGG - Intronic
957206003 3:77199300-77199322 CCTTGGTTTCCAAGGGAAACAGG - Intronic
958172759 3:89958291-89958313 CTTAGGTAAACAAAGCAACCAGG + Intergenic
962473998 3:135739936-135739958 CTTCTGTTACCATGGAAACCAGG - Intergenic
967455537 3:189681854-189681876 CATTTGTTACCTAGGGAACCAGG + Intronic
968663934 4:1810543-1810565 CTGGGGTCACCAAGGGCACCTGG + Intergenic
974806038 4:66882384-66882406 CTTATGTTTCAAAGGGAAGCAGG + Intergenic
977492906 4:97736684-97736706 CTTAGGTAAACAAAGGAGCCGGG + Intronic
983245851 4:165285854-165285876 ATTAGGATACAAAGGGAACACGG + Intronic
986472451 5:8089750-8089772 CTTAGGTTAACAAAGCAGCCGGG - Intergenic
986865865 5:11986242-11986264 ATGAGGTCACCAAAGGAACCTGG - Intergenic
988916445 5:35899035-35899057 CTTTTGTTTCCAAGGGAACTGGG - Intergenic
992348150 5:75901754-75901776 CTTAGGTAAACAAAGGAGCCGGG - Intergenic
995839549 5:116430596-116430618 CTTATGATACCAAGGCAAACGGG + Intergenic
997375340 5:133393706-133393728 AGAAGGTTACCAGGGGAACCTGG - Intronic
1001293112 5:170479088-170479110 CTTTGGTTACTAAGAGAACTAGG + Intronic
1001450799 5:171822910-171822932 CTTGTGTTTCCAAGGGAAGCAGG - Intergenic
1006051677 6:31350189-31350211 CTCAGGCCACCAAGGGAAGCAGG - Intronic
1010998341 6:82558864-82558886 CTTAGGTAAACAAAGCAACCTGG + Intergenic
1011397147 6:86921630-86921652 CTTAGGTTAACAAAGCAGCCGGG + Intergenic
1014120694 6:117721760-117721782 CTTAGGTTAACAAAGCAGCCGGG + Intergenic
1018232493 6:161688962-161688984 CTGAGATCACCAAGGGAAACTGG + Intronic
1022092909 7:27119207-27119229 CTTAAGTTAACAAGGCAATCTGG + Intronic
1023091776 7:36624583-36624605 CTCCAGTTCCCAAGGGAACCTGG - Intronic
1023845724 7:44119120-44119142 CTTTGTTTACCCAGGGCACCTGG + Intronic
1026577877 7:71589194-71589216 CTTAGCTTACTAAGGCAAGCTGG + Intronic
1027189695 7:75989495-75989517 CTCAGGGCACCAAGAGAACCCGG + Intronic
1027420121 7:78010660-78010682 CTTAAGGTACCAAGGTAACTTGG - Intergenic
1029105594 7:98172617-98172639 CTTAGGTCTCCAGGGAAACCAGG + Intronic
1035639484 8:1173549-1173571 CTTAGGTAAACAAAGCAACCGGG - Intergenic
1035791250 8:2307506-2307528 CTTAGGTAAACAAAGCAACCGGG - Intergenic
1035801555 8:2414199-2414221 CTTAGGTAAACAAAGCAACCGGG + Intergenic
1037136054 8:15462119-15462141 TTTAGGTTGCTAAGAGAACCTGG + Intronic
1039300181 8:36200915-36200937 CTTAGGTAAACAAGGCAGCCGGG - Intergenic
1039386093 8:37136878-37136900 CTGAGGTTACAAAATGAACCAGG + Intergenic
1044852673 8:96444439-96444461 CCTTGGTTACCAAGGAGACCAGG - Intergenic
1047281885 8:123452995-123453017 CTGAGGTTTCCATGGGGACCTGG + Intronic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1049513881 8:143043495-143043517 CTGAGGCCACCCAGGGAACCAGG + Intronic
1053573874 9:39337958-39337980 ATTAGGGTACCAAAGGAACTAGG - Intergenic
1053625052 9:39861034-39861056 ATTAGGGTACCAAAGGAACTAGG - Intergenic
1053838495 9:42166515-42166537 ATTAGGGTACCAAAGGAACTAGG - Intergenic
1053879818 9:42582194-42582216 ATTAGGGTACCAAAGGAACTAGG + Intergenic
1053892849 9:42712126-42712148 ATTAGGATACCAAAGGAACTAGG - Intergenic
1054095440 9:60896646-60896668 ATTAGGGTACCAAAGGAACTAGG - Intergenic
1054116901 9:61172566-61172588 ATTAGGGTACCAAAGGAACTAGG - Intergenic
1054218845 9:62389664-62389686 ATTAGGGTACCAAAGGAACTAGG + Intergenic
1054231873 9:62519505-62519527 ATTAGGGTACCAAAGGAACTAGG - Intergenic
1054590850 9:67009997-67010019 ATTAGGGTACCAAAGGAACTAGG + Intergenic
1058561300 9:106232025-106232047 CTTGGGTTAAGAAGGGAGCCTGG - Intergenic
1060940025 9:127537887-127537909 CTTGGGCTAAGAAGGGAACCGGG - Intronic
1061872484 9:133528264-133528286 CTGAGGCTACACAGGGAACCAGG - Intronic
1203421277 Un_KI270521v1:372-394 CTTAGGTAAACAAAGGAGCCAGG - Intergenic
1188561903 X:31478163-31478185 CTGAGGTGATCAAGGGATCCTGG - Exonic
1189049939 X:37634099-37634121 CTTAGGTAAACAAAGGAGCCCGG - Intronic
1190923750 X:54882732-54882754 CTTAGGTAAACAAAGGAGCCTGG - Intergenic
1192819902 X:74634226-74634248 CTGTGGTTACCAGAGGAACCAGG + Intergenic
1195117714 X:101716620-101716642 CTTAGGTAAACAAAGCAACCTGG - Intergenic
1198651233 X:138865819-138865841 CTTAGGTTAGCAAGAAAATCAGG + Intronic
1200162839 X:154018208-154018230 CTCAGGTGCCCAAGGGAGCCAGG + Intronic
1202014494 Y:20386223-20386245 CTTAGGTAATCAAAGCAACCGGG - Intergenic