ID: 1178363680

View in Genome Browser
Species Human (GRCh38)
Location 21:31970541-31970563
Sequence GCTGCTCTCCATCATGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178363680_1178363685 7 Left 1178363680 21:31970541-31970563 CCATACTCATGATGGAGAGCAGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1178363685 21:31970571-31970593 TATGCTTTCTGTTAAAGGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 219
1178363680_1178363687 17 Left 1178363680 21:31970541-31970563 CCATACTCATGATGGAGAGCAGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1178363687 21:31970581-31970603 GTTAAAGGAGGGGGCCTTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 121
1178363680_1178363683 5 Left 1178363680 21:31970541-31970563 CCATACTCATGATGGAGAGCAGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1178363683 21:31970569-31970591 GGTATGCTTTCTGTTAAAGGAGG 0: 1
1: 0
2: 0
3: 16
4: 149
1178363680_1178363686 8 Left 1178363680 21:31970541-31970563 CCATACTCATGATGGAGAGCAGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1178363686 21:31970572-31970594 ATGCTTTCTGTTAAAGGAGGGGG 0: 1
1: 0
2: 1
3: 21
4: 208
1178363680_1178363688 20 Left 1178363680 21:31970541-31970563 CCATACTCATGATGGAGAGCAGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1178363688 21:31970584-31970606 AAAGGAGGGGGCCTTGCTGGTGG 0: 1
1: 0
2: 0
3: 27
4: 334
1178363680_1178363682 2 Left 1178363680 21:31970541-31970563 CCATACTCATGATGGAGAGCAGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1178363682 21:31970566-31970588 GCAGGTATGCTTTCTGTTAAAGG 0: 1
1: 0
2: 1
3: 13
4: 187
1178363680_1178363684 6 Left 1178363680 21:31970541-31970563 CCATACTCATGATGGAGAGCAGC 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1178363684 21:31970570-31970592 GTATGCTTTCTGTTAAAGGAGGG 0: 1
1: 0
2: 3
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178363680 Original CRISPR GCTGCTCTCCATCATGAGTA TGG (reversed) Intronic
910862273 1:91753350-91753372 ACTGCACTCCAGCCTGAGTAAGG + Intronic
917967437 1:180187431-180187453 GGTGCTCTCCCTCATGGGTCAGG - Intronic
920701736 1:208223118-208223140 ACTCCTCTCCATCATGGGAAAGG - Intronic
924931681 1:248737867-248737889 GCTGCTCTTCTCCAAGAGTAAGG - Intronic
1064866838 10:19890180-19890202 GCAGTTCTCTATCATGACTATGG - Intronic
1066263653 10:33753651-33753673 CATGCTGCCCATCATGAGTAAGG - Intergenic
1069216626 10:65829135-65829157 ACTGCACTCCAGCATGAGCATGG + Intergenic
1069707095 10:70465791-70465813 GCTGTCCTCCATCCTGAGGAGGG - Intergenic
1070504823 10:77103878-77103900 CTTCCTCTCCATCATGAGCACGG + Intronic
1070662618 10:78318368-78318390 GCTGCTCTACAGCATGATTGGGG - Intergenic
1078023598 11:7673986-7674008 GCAGCGCTCCATCATGAGGCTGG + Exonic
1080035569 11:27706484-27706506 GCTGTTCTCCATCTTCACTAAGG - Intronic
1083023697 11:59532173-59532195 GCTCCCCTACATCGTGAGTAGGG + Intergenic
1083313060 11:61795573-61795595 GCCGTTCTCCATCATGCGAATGG - Exonic
1084629535 11:70338437-70338459 GCTTCACTTCATCATGGGTATGG + Exonic
1084901802 11:72315364-72315386 GCTGCTCTCGATCCTGAGGAAGG - Intronic
1089236638 11:117033205-117033227 GCTGCACTCCATCAAGTGTCAGG + Intronic
1095626368 12:44319242-44319264 CCTGCTCTCCATCCTGAGTCTGG + Intronic
1097659710 12:62415918-62415940 GCTGCTCTCATTCATAAGGAAGG - Intronic
1101345978 12:103886449-103886471 GCTGGTTTCCATCAGAAGTAGGG - Intergenic
1101683913 12:106997810-106997832 TCTGCTGCCCATCATGAGTGGGG + Intronic
1106823892 13:33497765-33497787 GATACTCTCCACAATGAGTAGGG - Intergenic
1110961963 13:81637991-81638013 GCTGTTCGCCATCAAGATTAGGG - Intergenic
1111557543 13:89901180-89901202 GCTGCTATCAATCTTGTGTATGG - Intergenic
1112302019 13:98239559-98239581 ACTGATCTCCAGCATGAGTGGGG + Intronic
1114439210 14:22732718-22732740 CCTTCTCTCCCTCATGAGGAGGG + Intergenic
1114947557 14:27703730-27703752 GATGCTCACCATCATTAGCAGGG - Intergenic
1115459279 14:33641615-33641637 GATGCTCTCCATCAGGAGAGAGG - Intronic
1116798088 14:49413205-49413227 GCTGCTCCCCACCCTGAGTGAGG - Intergenic
1121322023 14:92997345-92997367 GCCGCTTTCCCTCATGAGTTTGG - Intronic
1121882900 14:97516215-97516237 ACTGCTCTCCATCATGCCTTTGG + Intergenic
1128364260 15:66986165-66986187 GGTGCTCTCCAGCATGACTTTGG + Intergenic
1129224314 15:74158095-74158117 ACTTCTCTCCATCATGTGTCAGG + Intergenic
1130730652 15:86488577-86488599 TCTGCTCCCAATCATGTGTATGG - Intronic
1132387964 15:101415145-101415167 GCTGGTTTCCATGATGATTATGG - Intronic
1132690666 16:1180595-1180617 GCTGCTCTCCATAGTGTGTCGGG + Intronic
1134831923 16:17330826-17330848 GCTCCTCTACATCTTAAGTAGGG - Intronic
1138818260 16:60227693-60227715 GCTGCACTCCATCCTGGGCAAGG - Intergenic
1139659878 16:68413387-68413409 GGAGGTCTCCATCATGAGGAAGG + Intronic
1140132848 16:72179176-72179198 CCTGCTCTCCAGCAGGAGAAGGG + Intergenic
1140214991 16:73000099-73000121 GCTGCTCTCCAACAGGTGGAGGG + Intronic
1140600450 16:76469451-76469473 GCTGCTCCCCATCAGGGGTTGGG - Intronic
1150697688 17:67419866-67419888 GCTGCACTCCAGCCTGAGTGAGG + Intronic
1151693922 17:75704454-75704476 GCTTCTCTCCATCAGTAGGAGGG + Intronic
1152639698 17:81444449-81444471 GCCGCTCTGCATCATGAGGTGGG - Exonic
1156696587 18:39774936-39774958 GCTGCTCTACACCATGAGGCAGG + Intergenic
1158863247 18:61613695-61613717 TCTGGTCTCCAACAAGAGTATGG - Intergenic
1165444882 19:35851256-35851278 GATCCTCTCCATCCTGGGTATGG - Exonic
925569423 2:5293150-5293172 GATGCTCTCCAACATTAGAATGG + Intergenic
927680025 2:25132946-25132968 GATCCTCTTCATCATGAGCAAGG + Exonic
933210581 2:79563946-79563968 GATGGTCTCCATTATGAGGATGG - Intronic
935652759 2:105396434-105396456 GCTGCTCTCCATAATGTGAGTGG - Intronic
945905705 2:215590450-215590472 AGTGTTCTCCATCATGAATATGG + Intergenic
947024931 2:225726824-225726846 GCTGTTCTGCTTCATGAGGAAGG + Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1175651301 20:60726336-60726358 GCTGCTTCCCACCATGAGAAGGG - Intergenic
1175879998 20:62252299-62252321 GCTTCTCACCATCTTGATTATGG - Intronic
1178363680 21:31970541-31970563 GCTGCTCTCCATCATGAGTATGG - Intronic
1181996364 22:26885924-26885946 GCTACTCTGCCTCCTGAGTAGGG - Intergenic
950036966 3:9893125-9893147 GGTGCTCTCCATGATCAGCATGG + Exonic
953019593 3:39105039-39105061 GCTGCTCTCCATCATGAATGAGG + Intronic
954646653 3:52135776-52135798 GCTGCTGCACATCATTAGTAAGG + Intronic
955793951 3:62615933-62615955 GTTCTTCTCCATCATGAGAAGGG - Intronic
959917660 3:111835976-111835998 GCAGCCCTCCATCATGAGGTGGG - Intronic
960272181 3:115687276-115687298 GCTGATCTTCACAATGAGTATGG + Intronic
961032484 3:123618601-123618623 GCTTCTCTTCACCATGAATAGGG - Intronic
961819732 3:129569837-129569859 GCTGCTCTCCGTGGTGGGTAAGG - Exonic
962270940 3:133977729-133977751 CCTGATATCCATCATGAGTGAGG + Intronic
964846732 3:161052350-161052372 CCTGCTCTCCCTGATAAGTAAGG - Intronic
966708189 3:182940678-182940700 GCTGCTGTCCTTCATGAGGTAGG - Exonic
969306799 4:6330474-6330496 GCTGCCCTCCATCATGTGGGGGG + Intronic
969690224 4:8700043-8700065 GCTTTTCTCCATCCTGAGTCTGG + Intergenic
973322621 4:48825426-48825448 GCTGCTGCCCATCATGGGCAAGG - Intronic
976222845 4:82771918-82771940 GCTGCTTTTGATCATGAGTGTGG - Intronic
979085287 4:116401539-116401561 GCTGCTCTCCTTCATTAACAAGG + Intergenic
984383249 4:179022349-179022371 GCGGCTCTCGCTCCTGAGTATGG - Intergenic
986264707 5:6181709-6181731 GCTGCTCTCCTGCTTGAGAATGG + Intergenic
986290248 5:6393963-6393985 TCTGGTCTGCATCATCAGTATGG - Intergenic
989826735 5:45865530-45865552 ACTGCTCTCCACCATGAGGATGG - Intergenic
990550535 5:56872939-56872961 GCTGAGTTCCATAATGAGTAAGG - Exonic
992133703 5:73721173-73721195 GCTGCTCTCCACCATGTATGAGG + Intronic
998036843 5:138924694-138924716 GCTGCTCTCCAACACAGGTACGG + Exonic
1000049954 5:157554309-157554331 GCTGCTCTTCAGCAGGAGCACGG - Intronic
1000074004 5:157767884-157767906 GCCACTGTCCATCATGAGCAAGG + Intergenic
1003468122 6:6401007-6401029 GATGCTGTACATCATGAATAGGG + Intergenic
1006356281 6:33560362-33560384 CCTGCTTTCCATCAGGAGGAAGG + Intergenic
1011205238 6:84886996-84887018 GCTGTTCTCAATCATGAAAAAGG + Intergenic
1013626034 6:111937874-111937896 TCTGCACTACATCATAAGTAAGG - Intergenic
1015115703 6:129647177-129647199 GCTGGTGTCCATTATGTGTAAGG + Intronic
1015419883 6:132995207-132995229 GCTGCTCTCCTACATTTGTAAGG - Intergenic
1017428001 6:154342457-154342479 ACTGCTCTCCATCCTGAAAAGGG - Intronic
1022649177 7:32259210-32259232 CTTGCTCTCCATTCTGAGTATGG - Intronic
1024615630 7:51109174-51109196 GCTGCTCCCCATCCTGGGCATGG + Intronic
1026356239 7:69560068-69560090 GCTGCTCACCATCATTAGGGAGG + Intergenic
1029435609 7:100562493-100562515 CCTGCTCTCCAGGGTGAGTAAGG - Intronic
1031450372 7:121909901-121909923 GCTGCTTTCCATTATGAGTCTGG + Intronic
1036425357 8:8640797-8640819 GCTGCACTACATCATAATTATGG - Intergenic
1038152912 8:24958265-24958287 GCTGCAGTCTATCATGAGGACGG - Intergenic
1040068497 8:43169365-43169387 GCTGCTCTCTATTAGGAATACGG - Intronic
1040415734 8:47193852-47193874 GCTGCTCTCCATAAAGTGAAGGG + Intergenic
1042091012 8:65159737-65159759 GCTGTTCTCCATCATGGCAAGGG - Intergenic
1042874110 8:73425011-73425033 GCTGTTGTCCAGCATGAGCATGG - Intronic
1045094519 8:98784166-98784188 CCTGCTCTCCATCCTGGGTCTGG - Intronic
1046350076 8:112998014-112998036 GATGCTTACCAACATGAGTAGGG - Intronic
1049765683 8:144354266-144354288 GCTGCTCTTCATCATCAGCGTGG - Exonic
1056328959 9:85505851-85505873 GCTCCTCTCCATCATGGCTGAGG + Intergenic
1056942444 9:90967045-90967067 GCTGCTCTCCTGCATGAGGCTGG + Intergenic
1059030370 9:110687156-110687178 GCTCCTCACCATCCTGAGTGTGG + Exonic
1061654677 9:132079754-132079776 GCTGCGCTCCAGCGTGAGCAGGG - Exonic
1190440484 X:50470621-50470643 GCTGCTCTCCATCCTGAGGCGGG + Exonic
1190758906 X:53423539-53423561 TCTGCTCTCTATCATTAATAAGG + Intronic
1194059428 X:89178841-89178863 GCTGCTATCAATCATAATTAAGG - Intergenic
1194366318 X:93018674-93018696 GCTCCTCACTATCATGAATATGG - Intergenic
1198411744 X:136376503-136376525 GATTCTTTCCATCATGAGCAAGG + Intronic
1198700550 X:139392852-139392874 TCTGCTCTTCACCAAGAGTAGGG + Intergenic
1199608384 X:149594136-149594158 GCTGGTCTCCATCTTGAATAAGG - Exonic
1199630736 X:149775224-149775246 GCTGGTCTCCATCTTGAATAAGG + Exonic
1200674544 Y:6134936-6134958 GCTCCTCACCATCATGAATATGG - Intergenic
1201099262 Y:10659018-10659040 GCTGCACTCCAGCATGGGTGAGG - Intergenic
1201597977 Y:15693695-15693717 GCTACTCTCCTTAATGAGAATGG + Intergenic