ID: 1178366074

View in Genome Browser
Species Human (GRCh38)
Location 21:31989833-31989855
Sequence AGCAAAGACACCCACAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178366074_1178366075 30 Left 1178366074 21:31989833-31989855 CCATTTCTGTGGGTGTCTTTGCT 0: 1
1: 0
2: 5
3: 42
4: 452
Right 1178366075 21:31989886-31989908 CATTAGAGCACTCCTCCATACGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178366074 Original CRISPR AGCAAAGACACCCACAGAAA TGG (reversed) Intronic
900833927 1:4985428-4985450 AGCACAGACACCCAAGGAACTGG + Intergenic
901555418 1:10028150-10028172 TGAAAAGACATCCACAGAATGGG + Intergenic
902713662 1:18257745-18257767 AGCACAGACATCTACAAAAAGGG + Intronic
903684333 1:25119930-25119952 AGGAAACAGACCCAGAGAAATGG - Intergenic
904497827 1:30897142-30897164 AGCAGAGACAAGTACAGAAAAGG + Intronic
905177993 1:36149900-36149922 AGCAATGACTCACACAGAATTGG + Intronic
905341746 1:37282875-37282897 GGAAAAGAGACCCAGAGAAAGGG + Intergenic
905663625 1:39748169-39748191 GGCAAAGCAACCCACAGAACAGG - Intronic
905745511 1:40413882-40413904 AACCAAGACAACCACAGAACAGG - Intronic
906149245 1:43578044-43578066 AGCAAAAGGACCCTCAGAAAGGG - Intronic
906229584 1:44150123-44150145 AACAAAGAAACCCACAGCAAAGG - Intergenic
906576525 1:46895878-46895900 AAAAAAGACACCAACAGAATGGG + Intergenic
906595393 1:47071707-47071729 AAAAAAGACACCAACAGAATGGG - Intronic
906875554 1:49534415-49534437 AGCAAAGACACTGACTGAATTGG - Intronic
907255042 1:53172852-53172874 TGCAAAGACACAGACAAAAAAGG - Intergenic
907425176 1:54374980-54375002 AGCCAAGACTCCCACAGTGACGG - Intronic
910161016 1:84272198-84272220 AGAAAAAACCCCCATAGAAATGG - Intergenic
910242847 1:85106319-85106341 TGCAAAGACAACCACAGAATAGG + Intronic
911156398 1:94641786-94641808 AACAATGACACCCACAAATAAGG - Intergenic
912062541 1:105690441-105690463 TGCAAAGAAACCTGCAGAAATGG - Intergenic
913121021 1:115740837-115740859 AACAAAGAGGCCCACAGAGAAGG + Intronic
913710219 1:121475224-121475246 ACCAAACACACAAACAGAAAAGG - Intergenic
913999282 1:143679146-143679168 AAAAAAGACACCCAGAGCAAAGG - Intergenic
914504346 1:148275711-148275733 AAAAAAGACACCCAGAGCAAAGG + Intergenic
914860718 1:151383633-151383655 AACAATGACATCCACAGAACAGG - Intergenic
914946419 1:152070827-152070849 AGAAAAGGCACACAAAGAAAGGG - Intergenic
916394878 1:164374917-164374939 AGTAAATACACACACAGGAAAGG - Intergenic
917213267 1:172652330-172652352 AGCAAGGAAACCCACTGACATGG - Intergenic
918138990 1:181704227-181704249 AGCAAACACAGCCCCAGAGAAGG - Intronic
918277714 1:182969716-182969738 AGCAAATCCCCCCACAGATATGG - Intergenic
918555089 1:185789679-185789701 AGCAACCACAATCACAGAAATGG - Intronic
918746599 1:188209306-188209328 AGCCAAGAGACACACAGCAAGGG + Intergenic
919232910 1:194798746-194798768 AGCAAATACACACACAAAATGGG - Intergenic
919604007 1:199657851-199657873 TGAAAAGACAACCACAGAATAGG - Intergenic
1062993355 10:1841511-1841533 AGCAGAAGCAGCCACAGAAAGGG + Intergenic
1063165582 10:3459040-3459062 AGCAGAGAAAGCCACAGGAAGGG - Intergenic
1063305761 10:4898525-4898547 AGCGAAAACCCCCACAGAATGGG - Intergenic
1063367111 10:5498149-5498171 AGATAAGACACACACACAAATGG + Intergenic
1064534924 10:16349006-16349028 AGAAAAAACACCTACAGCAAAGG + Intergenic
1065314224 10:24446556-24446578 ACAAAAGAATCCCACAGAAATGG + Intronic
1066279769 10:33904848-33904870 AGAAAAGACAGCCACCGACAGGG - Intergenic
1066685126 10:37974326-37974348 TGAAAAGACACCCAAAGAATAGG + Intronic
1067047674 10:42993991-42994013 TGAAAAGACAACCACAGAATGGG + Intergenic
1067225002 10:44369935-44369957 ATCAAAGACACTCAGAGAAAAGG + Intergenic
1067519239 10:46983436-46983458 AGCAGAAACACACACAGCAAAGG - Intronic
1067643007 10:48068403-48068425 AGCAGAAACACACACAGCAAAGG + Intergenic
1068551744 10:58415123-58415145 ATTAAAGAAACCCACAGAAATGG + Intergenic
1069235203 10:66062753-66062775 AGCAAAGGCATCCACAGAACAGG - Intronic
1069843600 10:71355563-71355585 AGTGAGGACACCCCCAGAAAGGG + Intronic
1071806445 10:89126419-89126441 AACAAAGCCACACACAGAATTGG + Intergenic
1072599018 10:96906019-96906041 CACAAATACAACCACAGAAAAGG - Intronic
1073054192 10:100688615-100688637 AGGAAAGAAACCTCCAGAAAAGG + Intergenic
1073674469 10:105630082-105630104 AGCAGAGACACCCAGGGCAATGG + Intergenic
1074141154 10:110673887-110673909 AGCTATGCCACCCACAGTAAAGG - Intronic
1074209893 10:111320829-111320851 AGGAAGGAGACCAACAGAAAGGG - Intergenic
1074696002 10:116050785-116050807 AGCAGAGACCCAAACAGAAAAGG + Intergenic
1074777175 10:116775034-116775056 AGCAGAGACAGCCACAGGATGGG - Intergenic
1075704276 10:124490194-124490216 AACAGAGACACCCACAGACAGGG - Intronic
1075879814 10:125841183-125841205 AGCAAACACACACACACAAAAGG - Intronic
1076101044 10:127778672-127778694 AGCAAAGACACAAACACAAATGG + Intergenic
1076349734 10:129807795-129807817 GGCACAAACTCCCACAGAAAAGG - Intergenic
1077297697 11:1833882-1833904 AGCAAGGAGACAGACAGAAAGGG - Intronic
1077475124 11:2783931-2783953 TGAAAAGACAGCCACAGAATGGG - Intronic
1077707846 11:4505297-4505319 AGCAGTATCACCCACAGAAAAGG + Intergenic
1077736179 11:4794076-4794098 ATCAAATCCAACCACAGAAAAGG + Intronic
1077737172 11:4803742-4803764 ATCAAAGCCAGCCACAGAGAAGG + Exonic
1077770456 11:5212713-5212735 AGAAAAGACACACAGACAAATGG - Intergenic
1078361686 11:10674352-10674374 AGCAAAGACATTCAAATAAACGG + Intronic
1079345036 11:19644543-19644565 AGCAAAGGAACCCACAGGAATGG - Intronic
1080232554 11:30034321-30034343 AGCAAAGACACACACAGAGAAGG + Intergenic
1082718528 11:56644376-56644398 AGAAAAAACACACACACAAACGG + Intergenic
1082777270 11:57255963-57255985 TGCAAAGACATGCAAAGAAATGG + Intergenic
1083170393 11:60920920-60920942 AGCAAAGAAGGCCACAGAAATGG - Exonic
1083270390 11:61569358-61569380 AGCAAAGAGCTCCACAGAACTGG + Intronic
1085381414 11:76122605-76122627 AGTAAAAACACCTACAGCAAAGG - Intronic
1085908550 11:80794174-80794196 AACACAGAAACACACAGAAAAGG + Intergenic
1085967294 11:81542965-81542987 AGCAAACACACCAACTGATATGG + Intergenic
1086568762 11:88258777-88258799 AGAGAAGACACACACACAAATGG - Intergenic
1086571454 11:88289576-88289598 AGGAAAAACACACACACAAAAGG + Intergenic
1086991781 11:93311536-93311558 AGAAGAGACAACCACAGAATGGG + Intergenic
1087002974 11:93440120-93440142 GGCAAAGACACCAAAAGCAATGG - Intergenic
1088415329 11:109582302-109582324 AGCAAAGCAAACCACAGAAGGGG + Intergenic
1088883286 11:113988245-113988267 AGGAAATACACCTACAGAAGTGG - Intronic
1090761718 11:129842851-129842873 AGTAAAGATACCCATAGAATGGG + Intronic
1091554391 12:1561279-1561301 AGCAAAGAGTGCCACAGAAAAGG - Intronic
1092261310 12:6954728-6954750 AGCAGAGACATTCACAGAGAGGG - Intronic
1093182727 12:15985462-15985484 AGCAAAAACAACAACAGGAAAGG - Intronic
1093391334 12:18627373-18627395 AGCAATGACGCCCAAAGAAAGGG - Intronic
1094548974 12:31431851-31431873 AGCACACACAAACACAGAAAGGG + Intronic
1095633664 12:44406590-44406612 AGAAAAGACACCCAAAGACCGGG + Intergenic
1097307555 12:58086242-58086264 AGCAAAGCCACCCACTGACATGG + Intergenic
1097352234 12:58561413-58561435 AGAAAAGACGCACGCAGAAATGG + Intronic
1097526069 12:60737887-60737909 AGAAAAGACAACATCAGAAAAGG - Intergenic
1097975251 12:65678898-65678920 AACAAAGACACACAAAGATAAGG + Intergenic
1098723546 12:73932310-73932332 AGCCAAGGCATCAACAGAAAAGG - Intergenic
1099099206 12:78416323-78416345 AGCACACACACCCAAAAAAAGGG - Intergenic
1100573754 12:95869525-95869547 AACAAAGACACCAACAGGAAAGG - Exonic
1100770632 12:97918524-97918546 AGAAAAGACATCTACAGAATGGG - Intergenic
1101509247 12:105377936-105377958 AGCACAGATTCCCATAGAAATGG + Intronic
1101883199 12:108639875-108639897 AGCAAAAGCAGCCACAGACAAGG + Intergenic
1102101781 12:110284065-110284087 ATCAATGAAAACCACAGAAAAGG - Intronic
1103038692 12:117677092-117677114 ATCAAAGGCATCCAGAGAAAAGG + Intronic
1105592312 13:21804252-21804274 AGAAGACACACACACAGAAATGG - Intergenic
1105625790 13:22111170-22111192 AAGAAAGACACCCAGAGAAAGGG - Intergenic
1105773655 13:23636669-23636691 GGCAGAGACACCCACAGCAGAGG + Intronic
1106112299 13:26787551-26787573 AGCAATGGCAGCCACAGAAGGGG - Intergenic
1106119089 13:26843308-26843330 AGCTAAAACTCCCACAAAAATGG + Intergenic
1106176849 13:27339036-27339058 AGCCAGGACACCCACAGTGAAGG - Intergenic
1106386429 13:29290288-29290310 AGCAGAGACACTTACAGGAAAGG - Intronic
1107893375 13:44933700-44933722 AGCAAAAAGCCCCACAAAAAGGG + Intergenic
1108138430 13:47391511-47391533 TGAAGAGACACCCACAGAATGGG + Intergenic
1108455412 13:50608748-50608770 AGCAAAGACACTTAAATAAAAGG - Intronic
1108497741 13:51041986-51042008 AGCACAGACAGCCACAAAAATGG + Intergenic
1109814785 13:67566594-67566616 CACAAAGACACACACACAAAGGG + Intergenic
1109898769 13:68733439-68733461 AGCAAACACACACACACACAGGG + Intergenic
1112149052 13:96736286-96736308 GGCAAAGACACCCCAAGCAAAGG + Intronic
1113350190 13:109521941-109521963 AGCGAAGACTCCCGCAGCAAAGG - Intergenic
1113601264 13:111569918-111569940 AGGCAAGTTACCCACAGAAAGGG - Intergenic
1114398340 14:22387166-22387188 AGAAAAGGCACCCAGAGGAAGGG - Intergenic
1114571166 14:23669870-23669892 AGAAAAGACACCAAAAGCAAAGG + Intergenic
1115008762 14:28518996-28519018 CACAAAAACACACACAGAAAAGG - Intergenic
1115182938 14:30651185-30651207 AGTAAAGAAACCCACTCAAATGG + Intronic
1116041281 14:39689037-39689059 AGGAAAGACACAAAAAGAAAAGG - Intergenic
1117007198 14:51432888-51432910 AGCAAAGCCAGCAACAGAAATGG - Intergenic
1117989308 14:61418096-61418118 AGTAAACACAGCCACAGAACAGG - Intronic
1120079347 14:80198094-80198116 ATGAAAGAAACCCACAGAAGGGG - Intronic
1120956065 14:90083196-90083218 TGAAAAGACACCCACAGAAGGGG - Intronic
1122503522 14:102217413-102217435 AGAAAAGCCACCCAGAGAAAAGG - Intronic
1123827992 15:24102282-24102304 AGCCATGACCCCCTCAGAAATGG - Intergenic
1123842446 15:24261696-24261718 AGCCATGACCCCCTCAGAAATGG - Intergenic
1123852021 15:24367712-24367734 AGCCATGACCCCCTCAGAAATGG - Intergenic
1123857480 15:24427756-24427778 AGCCATGACCCCCTCAGAAATGG - Intergenic
1123862109 15:24478283-24478305 AGCCATGACCCCCTCAGAAATGG - Intergenic
1124401766 15:29354717-29354739 AGGAAACACACCAAGAGAAAAGG + Intronic
1125416701 15:39461263-39461285 AGCAAAGCCACACTCAGAAGAGG - Intergenic
1125442453 15:39717587-39717609 AGCAAACACTCCCATTGAAAAGG - Intronic
1125729831 15:41886862-41886884 TGCAAGGACAGGCACAGAAAAGG - Intronic
1126272895 15:46843501-46843523 AGTGAAGAAACCCACAGAATTGG - Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1129602887 15:77010427-77010449 AGCCAAGTCACACACAGCAAAGG - Intronic
1130536608 15:84790033-84790055 AGCAAACATACCCACAGACAAGG - Intronic
1131011182 15:89019705-89019727 ACCAAACAAACCAACAGAAAAGG + Intergenic
1131121867 15:89827935-89827957 AGCTGTGACACCCAGAGAAAGGG + Intergenic
1131580473 15:93638052-93638074 GGAAATGACACCCACAAAAACGG - Intergenic
1131666974 15:94581113-94581135 AACAGAGAGGCCCACAGAAAGGG + Intergenic
1132178948 15:99736973-99736995 ATCAAAGACATACACAGAAAAGG + Intergenic
1134050974 16:11137175-11137197 AAAAAAAACACCAACAGAAAAGG - Intronic
1134148545 16:11787444-11787466 AACAAAAACACACACACAAAGGG - Intronic
1134747477 16:16599404-16599426 AGCAGCGGCAGCCACAGAAAAGG + Intergenic
1135100072 16:19597454-19597476 AGCCAAGAAACCGATAGAAATGG + Intronic
1135303737 16:21351950-21351972 CGCCAAGACACCCGCAGACACGG - Intergenic
1135303745 16:21352008-21352030 CGCCAAGACACCCGCAGACACGG - Intergenic
1135677735 16:24431336-24431358 ATCAAAGACAACCACAGATGTGG + Intergenic
1135756102 16:25099785-25099807 AGGAAGGACAGCCACAGAGAAGG + Intergenic
1136015418 16:27397024-27397046 TGAAAAGACAGCCACAGAATGGG + Intergenic
1136679890 16:31953195-31953217 AGTAAAGACAGCCACAGACTTGG - Intergenic
1136709308 16:32222157-32222179 AGAAAAGACACACGCAGAGAAGG - Intergenic
1136758602 16:32707262-32707284 AGAAAAGACACACGCAGAGAAGG + Intergenic
1136780235 16:32894739-32894761 AGTAAAGACAGCCACAGACTTGG - Intergenic
1136809506 16:33163117-33163139 AGAAAAGACACACGCAGAGAAGG - Intergenic
1136815982 16:33273197-33273219 AGAAAAGACACACGCAGAGAAGG - Intronic
1136890171 16:33964906-33964928 AGTAAAGACAGCCACAGACTTGG + Intergenic
1137689554 16:50412727-50412749 AGAAAAGACACCAAAAGTAAAGG - Intergenic
1137880441 16:52040538-52040560 TGAAAAGACATCCACAGAATGGG - Intronic
1138097434 16:54223082-54223104 AACAAAGAAACACACAAAAATGG + Intergenic
1138144686 16:54597756-54597778 AGCAAGGACAACCACTGATAAGG - Intergenic
1138328338 16:56192960-56192982 AACAGAGACACAGACAGAAATGG - Intronic
1139118151 16:63982248-63982270 AGGAAAGTTACACACAGAAAAGG + Intergenic
1139273992 16:65710065-65710087 AACAAAAACACCCACATGAAAGG + Intergenic
1139680492 16:68558132-68558154 AGGAAAGACACTCAGAGAAGTGG - Intronic
1140171223 16:72607121-72607143 AGAAAAGACACCCTCACAGATGG + Intergenic
1140599288 16:76455995-76456017 AACAAAGAGAGCAACAGAAAGGG + Intronic
1141332786 16:83127372-83127394 AGCAAAGAGACCCACTAAGAGGG + Intronic
1142017211 16:87756113-87756135 AGCACAGACAACCACAAAGAGGG + Intronic
1142024823 16:87806785-87806807 CTGAAAGAGACCCACAGAAAAGG - Intergenic
1142303400 16:89271948-89271970 TGAAAAGACACGCACAGAATGGG + Intronic
1203060756 16_KI270728v1_random:967590-967612 AGAAAAGACACACGCAGAGAAGG + Intergenic
1203082861 16_KI270728v1_random:1158708-1158730 AGTAAAGACAGCCACAGACTTGG - Intergenic
1142957152 17:3529865-3529887 AGCAGAGTCAGGCACAGAAAAGG - Intronic
1143898999 17:10159167-10159189 AGCAATGGCACACACAGACAAGG + Intronic
1144233760 17:13235931-13235953 AGGTGAGACACCCAGAGAAATGG + Intergenic
1144877028 17:18403392-18403414 AGCAAACACACACACAAAATAGG + Intergenic
1145155202 17:20541016-20541038 AGCAAACACACACACAAAATAGG - Intergenic
1146186482 17:30727698-30727720 CACAAAGACACCCACGGAAGAGG - Intergenic
1147656683 17:42095188-42095210 AGCAGAGACAGCCACAATAAAGG + Intergenic
1148075898 17:44935029-44935051 ATCTGAGACACCCACAGAAGTGG + Intronic
1151035722 17:70796937-70796959 AGGAAAGTGACACACAGAAAAGG - Intergenic
1151602507 17:75114899-75114921 AGCAGAGACACTAAGAGAAAGGG - Intronic
1155036028 18:22025814-22025836 AACAAAAACACACACAGAAATGG - Intergenic
1155266262 18:24097274-24097296 AGCAAAGACAGCAAGAGCAAAGG - Intronic
1156150109 18:34231458-34231480 AGCAAACACCTACACAGAAAGGG + Intergenic
1156919703 18:42506105-42506127 AGAGAAGACAGACACAGAAAGGG + Intergenic
1156965520 18:43086690-43086712 TGCAAAGGGAGCCACAGAAAGGG + Intronic
1157185424 18:45536526-45536548 AGAAGAGACACACACAGAGAAGG - Intronic
1157474494 18:48012581-48012603 AGAGAAGACTCCCACAGAATAGG - Intergenic
1157493565 18:48139801-48139823 CCCAAAGCCACCCACAGAAGGGG + Intronic
1158912934 18:62085917-62085939 ACCATAGACACCCACAGAAATGG + Intronic
1159444381 18:68522826-68522848 AGCCCAGACACACACAAAAACGG - Intergenic
1159567094 18:70063934-70063956 AGAAAGAATACCCACAGAAAGGG - Intronic
1159610201 18:70516344-70516366 AGCTGGGAAACCCACAGAAAAGG + Intergenic
1159872095 18:73769892-73769914 ATCAAATACAGCAACAGAAAAGG - Intergenic
1159925793 18:74268250-74268272 AGGAATGTCACCCACACAAAGGG + Intronic
1160072629 18:75642050-75642072 AGCAAAGCCACACACAGCATAGG + Intergenic
1160203466 18:76814184-76814206 AGGAAGGACACCCACTGAAGGGG + Intronic
1160575473 18:79850783-79850805 TACAAAGAAACTCACAGAAAAGG - Intergenic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1162718623 19:12648683-12648705 GGAAAAGCCACACACAGAAATGG + Intronic
1162855458 19:13464898-13464920 AGAAAAGAAACCAAAAGAAAAGG - Intronic
1162972359 19:14188359-14188381 CACAAAGACACCCACGGAAGAGG + Intronic
1163079977 19:14932013-14932035 AGCAAAGAGCCCCAGAGTAAGGG + Intergenic
1163167661 19:15508870-15508892 ATCACAGATACCCAGAGAAAAGG - Intronic
1163208337 19:15820937-15820959 AGCTCAGTCACCCACAGACACGG - Intergenic
1164522070 19:28987268-28987290 AGCAGACACACCCAAATAAAGGG + Intergenic
1165046683 19:33110110-33110132 AGCAAAAACACTGACAGAACAGG - Intronic
1165654369 19:37520444-37520466 AGCAAAGACTCCCACATAAAAGG + Intronic
1166002639 19:39886923-39886945 GGCAAAGAGACACACAGAAAAGG + Intronic
1166305225 19:41933685-41933707 AGCAGAGACACCCTAAGAAAGGG + Intergenic
1166314658 19:41982279-41982301 GGCAGAGACACCCAAAGACAGGG + Intronic
1167386444 19:49166666-49166688 AGGACAGTGACCCACAGAAAAGG - Intronic
1167386494 19:49166956-49166978 AGGACAGAGACCCAGAGAAAAGG - Intronic
1167424273 19:49422061-49422083 AGGAAAGAGACCCAGAGAAAGGG + Intergenic
1167890093 19:52533208-52533230 AGAAAAGAAAACAACAGAAAAGG - Intronic
1168453708 19:56487502-56487524 TTCAAAGACATGCACAGAAAGGG - Intergenic
925405623 2:3603955-3603977 AGCATAGCCAGCCACAGACATGG - Intronic
926129623 2:10294077-10294099 AGCACAGGCAACCAAAGAAAAGG - Intergenic
926378140 2:12255177-12255199 AACAAAGACATCAACACAAATGG + Intergenic
927690948 2:25207715-25207737 AGCAAAGCCAACCACAGCAAAGG - Intergenic
928008948 2:27589594-27589616 AGCAAAGTAAACCAAAGAAAAGG - Intronic
928245006 2:29619465-29619487 AGCTCTGGCACCCACAGAAAAGG - Intronic
929245567 2:39698615-39698637 ACCAAAGACACCACAAGAAAAGG - Intronic
930080007 2:47438456-47438478 AGCAGAGAAGCTCACAGAAAAGG - Intronic
930110965 2:47678165-47678187 AGAAAAGTCACCCAGGGAAAGGG + Intergenic
930253246 2:49059911-49059933 TGAAAAGACAACCACAGAATGGG + Intronic
930461686 2:51687463-51687485 AACACACACACTCACAGAAAGGG + Intergenic
931138472 2:59431080-59431102 AGCAATGACACCAAAAGCAATGG - Intergenic
931247601 2:60504347-60504369 AGCCCAGCCACCCACTGAAAAGG + Intronic
935275941 2:101475045-101475067 AGCAATGACACTGACATAAATGG - Intergenic
935978167 2:108599969-108599991 AGAAAAGACAACCACAGAATGGG - Intronic
936135784 2:109892565-109892587 TGAAAAGACAACCACAGAATGGG - Intergenic
936208913 2:110478920-110478942 TGAAAAGACAACCACAGAATGGG + Intergenic
936648770 2:114402593-114402615 ACATAAGCCACCCACAGAAAGGG + Intergenic
936956550 2:118028364-118028386 AGCAACTGCACCAACAGAAAAGG - Intergenic
937327839 2:121002708-121002730 AGCCAAGACAACAACAGGAAAGG + Intergenic
937605070 2:123790259-123790281 AGCTAACACATCCCCAGAAAAGG + Intergenic
937953297 2:127404861-127404883 AACAAAGACAGCCCCAGAAGAGG - Intergenic
938547584 2:132348528-132348550 AGCAAAGAGACACACAGCATAGG + Intergenic
939042016 2:137201180-137201202 AACAAAGACACACACTAAAATGG - Intronic
941258532 2:163266176-163266198 AGAAAAGACACAAACAGACATGG + Intergenic
942328874 2:174800649-174800671 AGCAAAGACAGCCAGAGTGAAGG - Intronic
942735965 2:179112934-179112956 AGAAAAGAAAGACACAGAAATGG + Intronic
943366579 2:186972603-186972625 CGGATAGACACCCAGAGAAAAGG + Intergenic
944135101 2:196390533-196390555 AGCAAAGACAGGCACAGAAAAGG - Intronic
944867272 2:203874986-203875008 AGCACAGTCTTCCACAGAAAAGG - Intergenic
945213851 2:207412609-207412631 AGCAAAGGGACCCCCAGAAGTGG + Intergenic
945794272 2:214342423-214342445 AGCATAGATTCCCACAGGAAGGG + Intronic
945828771 2:214757768-214757790 AGCAGAGAGGCACACAGAAAAGG + Intronic
946266529 2:218547598-218547620 AAAAAAGACACACACAGACATGG + Intronic
946548872 2:220778130-220778152 AGAAAAGACAAGCACAGAAATGG + Intergenic
947611416 2:231527101-231527123 AGCAAAGTCCCCCAGAGAAGGGG - Intronic
948997738 2:241592303-241592325 AGCACAGACACACACAGCACAGG + Intronic
949001660 2:241618023-241618045 TGCCAAGGCACACACAGAAAGGG + Intronic
1168913925 20:1471063-1471085 AGCCAAGAGACACACAGCAAAGG - Intronic
1169054667 20:2610799-2610821 AAAAAAGACAACCAGAGAAAAGG - Intronic
1169789597 20:9395495-9395517 AGCAAAAACACGCAAAGAGATGG - Intronic
1170080855 20:12473227-12473249 AACAAACAAACCCACAGTAATGG - Intergenic
1170618415 20:17973680-17973702 TGCAGAGAGACCCACAGAAAAGG - Intronic
1170902206 20:20475179-20475201 ACCAATGCCAACCACAGAAAAGG - Intronic
1172150259 20:32785471-32785493 ACAAAATCCACCCACAGAAATGG - Intronic
1172526207 20:35601816-35601838 AGGAAAGACACCCGCACATAGGG + Intergenic
1172652748 20:36516046-36516068 AGCAAAGGAACCAACAGCAAAGG + Intronic
1173002384 20:39113769-39113791 AGCAAAGAATCGCAGAGAAATGG - Intergenic
1173270000 20:41525229-41525251 AGGAATGACACCCACAGGAAGGG - Intronic
1173897491 20:46562028-46562050 AATAAAGACAGCCAGAGAAATGG - Intronic
1174992380 20:55525270-55525292 AGCAAAGACACAATGAGAAAAGG - Intergenic
1175379632 20:58553834-58553856 AGCAAAGCCACAAGCAGAAAAGG + Intergenic
1175786271 20:61713597-61713619 GCCAAAGACTCCCCCAGAAAAGG + Intronic
1177802433 21:25841079-25841101 AGCCGAGAGACCCAGAGAAAGGG + Intergenic
1178366074 21:31989833-31989855 AGCAAAGACACCCACAGAAATGG - Intronic
1178704398 21:34861397-34861419 AGCAATGACAGCCACAGACGGGG + Intronic
1179119660 21:38531091-38531113 AGCAAGGGCACACACACAAAGGG + Intronic
1179231624 21:39509006-39509028 AGGAGAGACAGCCACAGAAGAGG + Exonic
1179338391 21:40480135-40480157 AACAAGGACTCCCAGAGAAATGG - Intronic
1179419858 21:41226836-41226858 TGCAAACCAACCCACAGAAATGG - Intronic
1181727923 22:24824429-24824451 AGCACAGACACCAACAGACTTGG - Intronic
1181766663 22:25097320-25097342 AACAAAGACCCCCATAAAAATGG + Intronic
1182214800 22:28706952-28706974 AGAAAAGACACATATAGAAAAGG + Intronic
1184394092 22:44222384-44222406 GACTAAGACACCCACAGAAGAGG - Intergenic
949757068 3:7424233-7424255 AACAAAGACAACCACAACAATGG - Intronic
949825080 3:8156651-8156673 AGAACAGAGACCCACAGAAGAGG - Intergenic
951823675 3:26843306-26843328 AGCAAACACACTCAAAGAACAGG + Intergenic
951995296 3:28720967-28720989 AGCAAAAACCCCACCAGAAATGG - Intergenic
953503521 3:43460847-43460869 AGAGCAGACACTCACAGAAAAGG + Intronic
953968331 3:47327297-47327319 ATCAAAGACACCCAAAAATAAGG + Intronic
954470462 3:50689906-50689928 TGAAAAGACAACCACAGAATGGG - Intronic
955346331 3:58164647-58164669 AGCAAAGCCACCCACAGGGGTGG + Intronic
957123868 3:76132843-76132865 AGCAAAGTCACACACAGTAGTGG + Intronic
957158767 3:76581158-76581180 AGCAAAGACAAACACATATAAGG + Intronic
957667141 3:83247513-83247535 TGCAAAGACACACATACAAAGGG - Intergenic
959884857 3:111487942-111487964 AACTAAGACCCCCACAGAAAGGG + Intronic
960821152 3:121733697-121733719 AGCATAGACACACAGATAAATGG + Intronic
961426925 3:126855734-126855756 TGCAAAGATGCCTACAGAAATGG - Intronic
961908619 3:130289766-130289788 TGAAAAGACACCCACAGAATAGG - Intergenic
962488655 3:135869091-135869113 AGCAAAGACACTGAGGGAAATGG + Intergenic
962704135 3:138027025-138027047 GGAGAAGAGACCCACAGAAACGG + Intronic
964063235 3:152551312-152551334 AGGAAAGAAACAAACAGAAAGGG - Intergenic
964631884 3:158819540-158819562 AGCAAAAACAGCAACTGAAAGGG - Intronic
964652493 3:159027150-159027172 TGAAGAGACACCCACAGAATGGG + Intronic
964752976 3:160069125-160069147 TGGATAGACACCCAGAGAAAAGG + Intergenic
964929657 3:162001772-162001794 AGGAAATACATTCACAGAAAAGG - Intergenic
965174564 3:165315252-165315274 TGAAGAGACACCCACAGAATGGG - Intergenic
965280328 3:166743496-166743518 AAGTAAGACAACCACAGAAAGGG - Intergenic
965896667 3:173585405-173585427 AGCCACGACAGCCGCAGAAACGG - Intronic
966238311 3:177727300-177727322 AGCAAACATATCCTCAGAAAGGG - Intergenic
966293912 3:178395443-178395465 AGAAAAGACACACACAGTGAGGG - Intergenic
967040447 3:185687278-185687300 AGCAAGGACACAGACAGACAAGG + Intronic
967446103 3:189568363-189568385 AAAAGAGACACCCACAGAAAGGG - Intergenic
968854378 4:3108180-3108202 AGCATAGTCACCCACGGGAAGGG + Intronic
969198026 4:5578683-5578705 AAGAAAGACACACACAGAAACGG + Intronic
969236073 4:5865850-5865872 TGCACACACACACACAGAAAGGG + Intronic
970426618 4:15951933-15951955 AGCAGAGAGGACCACAGAAAAGG + Intergenic
973161407 4:47021494-47021516 ATCAAGGCAACCCACAGAAATGG + Intronic
974606840 4:64163748-64163770 TTCAAAGACACCTCCAGAAAAGG - Intergenic
974916138 4:68181241-68181263 AACAAAAACTCCCACAAAAATGG + Intergenic
975237802 4:72020786-72020808 AGCAAAGACCCCCCCAGAAGAGG - Intergenic
975519058 4:75278542-75278564 GGCAGAGACACACACAAAAAAGG + Intergenic
975548250 4:75583098-75583120 AGAAGAGAGACCGACAGAAATGG + Intronic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
976825170 4:89252772-89252794 AGAATAGAAACCTACAGAAATGG - Intronic
977238362 4:94536172-94536194 AGCAGAGACACTCGCAGGAAGGG + Intronic
977647760 4:99433400-99433422 AGGAAACACACACACAAAAATGG + Intronic
978835372 4:113143068-113143090 ATAAAAGACAACCACAGATAGGG - Intronic
978979914 4:114930884-114930906 TGAAAAGACACACACACAAAAGG + Intronic
979699551 4:123652695-123652717 AGTAAATAATCCCACAGAAATGG - Intergenic
979913796 4:126404873-126404895 ATCAGAAACACCCACAGACATGG + Intergenic
980650184 4:135703526-135703548 TACAAAGACATACACAGAAAAGG + Intergenic
980781056 4:137492970-137492992 AGGAAAGAGACACGCAGAAATGG + Intergenic
982971131 4:161988367-161988389 AGGAAAGACAACTACAGCAAAGG + Intronic
983689258 4:170448303-170448325 AGCACACACACACAGAGAAATGG - Intergenic
984776992 4:183490452-183490474 AGCAAATTCAGCCACAGAATGGG - Intergenic
984939721 4:184920345-184920367 AGAAATGACAGCCAAAGAAAGGG - Intergenic
985976639 5:3423985-3424007 AAAAAGGCCACCCACAGAAAGGG + Intergenic
986297959 5:6455347-6455369 AGATAAGACACCAGCAGAAATGG + Intronic
986305034 5:6508369-6508391 AGGAAAGAGACGCACAGACAAGG + Intergenic
986561588 5:9065645-9065667 GGAAAAGATACCAACAGAAAAGG - Intronic
987029160 5:13959998-13960020 AGGAAAAACACCCCCAGAACTGG + Intergenic
987669030 5:20984210-20984232 GGTACAGAAACCCACAGAAATGG - Intergenic
988068635 5:26257334-26257356 ACCACACACACACACAGAAAAGG - Intergenic
988410169 5:30876514-30876536 AGCAAAGACACTGACCGATAAGG - Intergenic
988531683 5:32033234-32033256 AACAAAACCACACACAGAAAAGG + Intronic
988634612 5:32969495-32969517 AGCTAAGAAACCCACAGTGAGGG - Intergenic
990043931 5:51405224-51405246 AGAAAAATCACCCAGAGAAAGGG + Intergenic
992004738 5:72466278-72466300 AGCAAAAACAGCCATAGAGAAGG - Intronic
992446446 5:76838425-76838447 AGCAAAGACAACCACATCCAAGG - Intergenic
992599431 5:78383454-78383476 AGCAAACACAACAACAAAAAAGG - Intronic
992681469 5:79157609-79157631 AACAAAAAAACACACAGAAAAGG - Intronic
993001508 5:82385852-82385874 ATCAAAGACATCCACAGGCAGGG + Intronic
993176311 5:84490326-84490348 AGAGAAAACACACACAGAAAAGG - Intergenic
993916688 5:93752171-93752193 AGTAAAGACAGCCATAGGAAGGG + Intronic
994094383 5:95835797-95835819 AGCAAAGTCACCAACAGCACTGG + Intergenic
994561582 5:101380652-101380674 GGCAAAGACACACACGCAAAAGG - Intergenic
995275626 5:110274555-110274577 TGAAAAGACCCCCACAGAGAGGG - Intergenic
995367553 5:111380693-111380715 AGCAAAAACACAGAAAGAAATGG - Intronic
996007463 5:118440113-118440135 AGCAAAGACAGCCTCAAAACAGG + Intergenic
996132898 5:119803432-119803454 AGTGAAAACACCCACAGAATGGG - Intergenic
996873458 5:128216650-128216672 GGCAAACACACGCAAAGAAAGGG + Intergenic
997167034 5:131672262-131672284 AGCAATGAGATCCACAGGAATGG - Exonic
997988255 5:138522201-138522223 AGTAAAAAGACCCACAGAATGGG + Intronic
998120879 5:139576405-139576427 AGAGAAGACACACACAGAGAAGG - Intronic
998849750 5:146341467-146341489 CCGAAAGACACCCACATAAAGGG - Intergenic
1000520324 5:162286953-162286975 AGCAAAGACAAACACATACAAGG - Intergenic
1000532305 5:162438390-162438412 AACAGGGACACCCAAAGAAAGGG - Intergenic
1000819675 5:165967782-165967804 GGCAGAGACACACACAAAAAAGG - Intergenic
1001274375 5:170339588-170339610 AGCAAAGATGCCCACAGCAGTGG + Intergenic
1001571963 5:172735953-172735975 GGCAAAGACAGACACAGAGAGGG + Intergenic
1004912240 6:20297873-20297895 AGGACACACACACACAGAAATGG - Intergenic
1005345584 6:24886584-24886606 AGCAAACAAACCCAAAGTAAGGG - Intronic
1005852631 6:29833203-29833225 ATCAAGGACACCCACAGTATTGG + Intergenic
1005876222 6:30011720-30011742 ATCAAGGACACCCACAGTATTGG + Intergenic
1006533234 6:34675293-34675315 AGCAAAAACAACAACAAAAAAGG + Intronic
1007142057 6:39585962-39585984 GGCAATGTCACCCAAAGAAATGG - Intronic
1007531615 6:42547818-42547840 GGCAAAGCCACCCACAAAACCGG - Intergenic
1007934736 6:45722903-45722925 CTCAAAGACACCAAAAGAAATGG - Intergenic
1010868936 6:81014527-81014549 GGCAAAGACACACAAAAAAAGGG - Intergenic
1011237362 6:85232126-85232148 AGCAAAGACAGGCACACAGAGGG + Intergenic
1011305659 6:85923388-85923410 TGCAAAGCCTCCCACAGAGATGG - Intergenic
1013353811 6:109330066-109330088 ATCAAAGCAACCCACTGAAAAGG + Intergenic
1014158010 6:118134642-118134664 AGCAAAGACAAACACAGAGTAGG - Intronic
1014523602 6:122474705-122474727 AGAATAGACATGCACAGAAATGG + Intronic
1014990621 6:128070902-128070924 AGCAAAAATATCAACAGAAAAGG - Intronic
1015274735 6:131372574-131372596 AGCACAGACATACACATAAAAGG + Intergenic
1015698855 6:136012255-136012277 AGCAGAGACACCTCAAGAAAGGG - Intronic
1016012127 6:139148221-139148243 AGCAAAGACAACCATAAATAAGG - Intronic
1016402402 6:143694548-143694570 AGCAAAACCAAACACAGAAAAGG - Intronic
1016766997 6:147806120-147806142 AAGAAAGACAGCTACAGAAATGG + Intergenic
1017182115 6:151563821-151563843 AGCTCAGAGCCCCACAGAAAGGG - Intronic
1017187757 6:151619301-151619323 ATCCAATACACCCACAGCAATGG + Exonic
1017709217 6:157151006-157151028 AACAAACACACCAACAAAAATGG - Intronic
1018048450 6:159986069-159986091 TGCAAAGGCCCCCACAGAAGCGG - Intronic
1019377392 7:700153-700175 AACACAGAGAACCACAGAAAAGG + Intronic
1021369194 7:19820111-19820133 AGAACAGACACACAGAGAAATGG - Intergenic
1021521887 7:21546946-21546968 AGTAAAGAGATCCACAGCAAAGG + Intronic
1021554834 7:21908833-21908855 AGGAGAGACAGTCACAGAAAAGG + Intronic
1021783132 7:24126072-24126094 AGGAAAGACTCCCCCAGGAAAGG + Intergenic
1022313650 7:29222488-29222510 AGCACAGACACACAGAGCAATGG + Intronic
1023901403 7:44483362-44483384 AGCAAAAATATCCTCAGAAATGG + Intronic
1024581115 7:50801931-50801953 ACCAGAGACACCCACAGGATGGG + Intergenic
1024820179 7:53319311-53319333 AGTAAAAACACAGACAGAAAGGG + Intergenic
1025157040 7:56616468-56616490 AGCCAAAACACCTACAGAATGGG + Intergenic
1026205224 7:68251531-68251553 AGCCAAGTCACCAAAAGAAATGG - Intergenic
1026512051 7:71035645-71035667 AGCCCAGACACCCGCAGAGAGGG + Intergenic
1027440443 7:78213712-78213734 AGCAAAGTAACCTACAAAAATGG - Intronic
1028415085 7:90571463-90571485 AACAAACACACACACACAAAAGG - Intronic
1029551155 7:101237760-101237782 AGCAGAGAGACCCACAGAGCAGG - Exonic
1031444921 7:121841208-121841230 AGCAAAGAGACACAAAGAGAAGG - Intergenic
1032103546 7:129004028-129004050 AGGAAAGATACCAACATAAATGG + Intronic
1033024727 7:137761114-137761136 AACAAAGAAACAGACAGAAAGGG - Intronic
1033383180 7:140844444-140844466 AGGAAAGACAGCAGCAGAAATGG - Intronic
1034232779 7:149545821-149545843 AGAAAGGACACCCACCCAAAGGG - Intergenic
1034557518 7:151859501-151859523 AGCTAAGACACACACTTAAAGGG + Intronic
1034760895 7:153670860-153670882 GGCACAGACACACAGAGAAAAGG - Intergenic
1035129572 7:156640113-156640135 AGCAAAGGGATCCACAGAGAAGG + Exonic
1035221885 7:157411065-157411087 AGCACAGACTCACACAGCAAAGG - Intronic
1036506387 8:9360272-9360294 AGCAGAGACCCCGACTGAAAGGG - Intergenic
1037974600 8:23200531-23200553 AGCACAGCCACCAACAGCAACGG + Exonic
1039189533 8:34957091-34957113 AGCAGAGACACACGAAGAAATGG + Intergenic
1039195518 8:35027061-35027083 CTCAAAGACACATACAGAAAAGG - Intergenic
1039891611 8:41689583-41689605 AGCAACGAAAACCACAGAGACGG + Intronic
1040358626 8:46643632-46643654 AGCAAAAACAGCTACAGAATGGG - Intergenic
1040375382 8:46819685-46819707 AGCCAAAACACCTACAGAATAGG - Intergenic
1040382967 8:46890995-46891017 AGCAAAAACACCTACAGAATGGG + Intergenic
1040590640 8:48789269-48789291 AGAGAAAACACACACAGAAAAGG - Intergenic
1040933950 8:52764181-52764203 AGCAAAGGCACCAACACCAATGG + Intergenic
1041609069 8:59822096-59822118 TGCAAAGACAACCCCAGAATGGG - Intergenic
1043167696 8:76925002-76925024 AGAATTGGCACCCACAGAAAAGG + Intergenic
1043215887 8:77587265-77587287 AAAAAAGACACTCACAAAAAAGG + Intergenic
1043239920 8:77919443-77919465 AGCCCATACAGCCACAGAAAGGG - Intergenic
1043358541 8:79441916-79441938 AGAAAAGACACAGACAGAAGAGG + Intergenic
1044303371 8:90610304-90610326 ACCAAAGTCACTCAGAGAAAGGG + Intergenic
1045126381 8:99094893-99094915 ATCAAAGATACCAACACAAAGGG - Intronic
1045427459 8:102081158-102081180 AGAAGAGCCACCAACAGAAAGGG - Intronic
1045482264 8:102601649-102601671 AGCAAAGATAGTGACAGAAATGG - Intergenic
1047088966 8:121552363-121552385 AAGAAGGACACCCACAAAAATGG - Intergenic
1047199757 8:122755321-122755343 TGTAAAGACACACACACAAAAGG - Intergenic
1047206497 8:122806589-122806611 AGCAAAGCCAACAACGGAAAGGG + Intronic
1048405048 8:134110505-134110527 AGCCAGCACACCCACAGAGAAGG - Intergenic
1048714961 8:137258146-137258168 AACAAAGAAACCCAGAGCAAAGG - Intergenic
1049060734 8:140274220-140274242 AAAAAAAAAACCCACAGAAAAGG + Intronic
1049514764 8:143048229-143048251 AGCACATATATCCACAGAAACGG - Intronic
1050682155 9:8124195-8124217 AGGAAAGCCACCCTCAGAACTGG - Intergenic
1051428081 9:16954483-16954505 CACACAGACACACACAGAAATGG - Intergenic
1052841493 9:33295107-33295129 AGAGAAGATACCCACAGAAAAGG + Exonic
1053305107 9:36979274-36979296 ACCAAACACACACACAGGAATGG + Intronic
1053678820 9:40465433-40465455 AACAAAAACATCCACAAAAATGG + Intergenic
1053928805 9:43093786-43093808 AACAAAAACATCCACAAAAATGG + Intergenic
1054284903 9:63159509-63159531 AACAAAAACATCCACAAAAATGG - Intergenic
1054291898 9:63300971-63300993 AACAAAAACATCCACAAAAATGG + Intergenic
1054389917 9:64605514-64605536 AACAAAAACATCCACAAAAATGG + Intergenic
1054505798 9:65910862-65910884 AACAAAAACATCCACAAAAATGG - Intergenic
1055118340 9:72629572-72629594 AACACACACACACACAGAAACGG - Intronic
1055388302 9:75788752-75788774 AAAAAAAACACCCACAGAATGGG - Intergenic
1055978199 9:81974826-81974848 AGCAAAGACATGGATAGAAATGG - Intergenic
1056217436 9:84418369-84418391 ATCAAAGACACTCTAAGAAAAGG - Intergenic
1056961238 9:91125948-91125970 AGGAAAAAAACCCACAGAACAGG - Intergenic
1057052435 9:91935849-91935871 AGCAATGACCCCCAGAGAGAAGG + Intronic
1058511424 9:105722824-105722846 AGGAGAGAAACCCACAGAGAAGG - Intronic
1059822141 9:117985056-117985078 AGAAATGAAACCCACAGAAAAGG + Intergenic
1060366979 9:123026816-123026838 AGCTAAGCCACCAACACAAAAGG - Intronic
1061007390 9:127935852-127935874 AGCAGAGCCACCCACACACAGGG + Intronic
1061379938 9:130248975-130248997 AGCAAAGAAACCTAAAGAAATGG - Intergenic
1062017069 9:134296364-134296386 AGCAAAGGCACCCCCATAACAGG + Intergenic
1062701817 9:137910324-137910346 TGAAAAGAAACCTACAGAAAGGG - Intronic
1062725226 9:138069298-138069320 AGCAAGGGCACCCAGAGAGAGGG + Intronic
1186467932 X:9798518-9798540 AGCAAAGAATTCCACAGAGATGG - Intronic
1190751563 X:53366452-53366474 AGCCAAGAGAATCACAGAAATGG - Intergenic
1190804020 X:53818131-53818153 AGCCAAGAGAATCACAGAAATGG - Intergenic
1191576913 X:62716126-62716148 AGTCAACAAACCCACAGAAAAGG + Intergenic
1192588865 X:72343115-72343137 ATCAAAGACCCCAAGAGAAATGG - Intronic
1193747875 X:85304659-85304681 AGCAAAGACACCTTAAAAAAAGG - Intronic
1195804898 X:108753381-108753403 TGAAAAGACACCCACAGAAGGGG - Intergenic
1195846284 X:109232468-109232490 GGCAGAGACACACACAAAAAAGG + Intergenic
1196539744 X:116893774-116893796 AGTGAACACATCCACAGAAAAGG - Intergenic
1196595006 X:117534998-117535020 AGCAAAGAATTCCAGAGAAAGGG - Intergenic
1198188901 X:134284290-134284312 AGGAAACAAACCCACAGAATGGG - Intergenic
1198398058 X:136242960-136242982 AGCATAAACAACCACAGAAAAGG + Intronic
1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG + Intronic
1198624774 X:138558713-138558735 AGCCAATATACCCACAGGAATGG - Intergenic
1199480035 X:148288349-148288371 AGATTTGACACCCACAGAAAAGG - Intergenic
1200843484 Y:7807827-7807849 AGCCAAAACACCTACAGAATGGG + Intergenic
1200896087 Y:8377590-8377612 AGCAAAAACACCTACAGAATAGG + Intergenic
1201558116 Y:15286070-15286092 AGCAAAGACAAAGACAGCAAAGG - Intergenic
1202259391 Y:22954290-22954312 AGCAAAAACACCTACAGGATGGG - Intergenic
1202262556 Y:22984712-22984734 AGCCAAAACACGTACAGAAAGGG - Intronic
1202270898 Y:23073182-23073204 AGCTAAAACACCTACAGAATGGG - Intergenic
1202295128 Y:23347500-23347522 AGCTAAAACACCTACAGAATGGG + Intergenic
1202412377 Y:24588034-24588056 AGCAAAAACACCTACAGGATGGG - Intergenic
1202415546 Y:24618453-24618475 AGCCAAAACACGTACAGAAAGGG - Intronic
1202423893 Y:24706926-24706948 AGCTAAAACACCTACAGAATGGG - Intergenic
1202446896 Y:24963159-24963181 AGCTAAAACACCTACAGAATGGG + Intergenic
1202455241 Y:25051633-25051655 AGCCAAAACACGTACAGAAAGGG + Intronic
1202458403 Y:25082036-25082058 AGCAAAAACACCTACAGGATGGG + Intergenic