ID: 1178368472

View in Genome Browser
Species Human (GRCh38)
Location 21:32007411-32007433
Sequence CATTCTGCACAGATGAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178368472 Original CRISPR CATTCTGCACAGATGAAGAC AGG (reversed) Intronic
900750721 1:4395475-4395497 CAGCCTGAACAGAAGAAGACAGG + Intergenic
901880069 1:12188670-12188692 CAGTCTGCACTGATGATGGCTGG - Intronic
903382577 1:22907267-22907289 CATTATGCACAGGAGAAAACGGG + Intronic
903418706 1:23202718-23202740 CACTCTGCACAAATCAGGACAGG + Intergenic
904968323 1:34398405-34398427 CTTTCTGCACATATAAAGCCTGG + Intergenic
905635539 1:39548932-39548954 CAGTTTGGTCAGATGAAGACTGG - Intergenic
905868530 1:41389934-41389956 TATTCTGCACATATGAAGGAAGG + Intergenic
906305595 1:44716728-44716750 CATACTGGACAGATGAAGATTGG - Intronic
908346606 1:63239643-63239665 CATTCTCCACAAAAGAAAACTGG + Intergenic
909907349 1:81214506-81214528 CATTCTTCACAAATTAAGATTGG - Intergenic
910291396 1:85603390-85603412 AATTGTCCACAGATGATGACTGG - Intergenic
914676685 1:149911598-149911620 CATTCTGGACAGCAGCAGACAGG + Intronic
916481137 1:165215544-165215566 CATCCTTCACAGAGGAGGACAGG - Intronic
916726493 1:167528096-167528118 AATTCAGCTCAGATAAAGACTGG - Intergenic
917063926 1:171071084-171071106 CATTCAGAAAAGAGGAAGACGGG - Intergenic
919511480 1:198471068-198471090 CATTCTGCAGAAAAGAAAACTGG - Intergenic
921924165 1:220697949-220697971 CAGGCAGCACAGAAGAAGACAGG - Exonic
1064895855 10:20235558-20235580 CATTTTGCAGAAAAGAAGACAGG + Intronic
1066114820 10:32230308-32230330 CAGTCTGCACCAATGCAGACAGG - Intergenic
1068328414 10:55527765-55527787 CATTCACAACAGCTGAAGACAGG - Intronic
1068798747 10:61115034-61115056 CAATCTACAGACATGAAGACTGG - Intergenic
1069821625 10:71232070-71232092 CCTCCTGCAAAGATGAAGAAAGG + Intronic
1070911957 10:80126831-80126853 CATTCTGCACAGATGAAGAGGGG - Intergenic
1071821191 10:89282750-89282772 CACTCTTTACAGATGAAGAACGG + Intronic
1072195058 10:93110386-93110408 AAATCTGCACAGATGCAGCCAGG - Intergenic
1074150912 10:110759121-110759143 CATCCTGCACAGACAAAGGCTGG - Intronic
1074492522 10:113951880-113951902 CAGCCTGCACAGACGAATACAGG - Intergenic
1077196772 11:1284955-1284977 CATCCTGCACAGATGCAGAAAGG - Intronic
1078800228 11:14636295-14636317 CATTCTAAAAAGATGAGGACAGG - Intronic
1079474664 11:20816738-20816760 CATTCTGAACAGGTAAACACTGG - Intronic
1080690402 11:34552565-34552587 CATCCTGCACAGAAGCAGAAAGG + Intergenic
1083103231 11:60332049-60332071 CAGTCTGAACAGACAAAGACAGG + Intergenic
1086143401 11:83523984-83524006 CCTTTTGCACAGAGGAAGAAGGG - Intronic
1087933311 11:104003119-104003141 CATACTGCACAAATGTAAACAGG + Intronic
1088784745 11:113171163-113171185 CATTTTGCAAAGATGGAAACAGG + Intronic
1089598983 11:119601760-119601782 CATTCTGCTCAGCTGCAGAACGG - Intergenic
1090775430 11:129960885-129960907 AATGCCGCACAGGTGAAGACTGG - Exonic
1092874558 12:12836889-12836911 CTTTTAGCATAGATGAAGACTGG + Intergenic
1098366362 12:69707260-69707282 CATTCTGGAAAGCTAAAGACAGG + Intergenic
1099262474 12:80400536-80400558 CATTCTGCATAGAAGAAGGGAGG - Intergenic
1100280028 12:93109551-93109573 CATTATGCACATATAAAGACTGG - Intergenic
1104191930 12:126490325-126490347 CATACTGCACAGCTGGAAACAGG + Intergenic
1104748137 12:131222581-131222603 CATTCAGCACTGAGGCAGACAGG - Intergenic
1105291640 13:19057220-19057242 CATCCTTCACAGACGAAGGCGGG + Intergenic
1106289445 13:28347170-28347192 TAATCTGCAGAGATGAAGGCAGG + Intronic
1106575246 13:30968405-30968427 GAATCTGCACTGATGAAGCCTGG - Intronic
1106972136 13:35154204-35154226 CCTTCTGCTCAGACTAAGACAGG - Intronic
1109439223 13:62347447-62347469 CATTCTGCACAGAAGATAATTGG + Intergenic
1114565802 14:23631915-23631937 CAACCTGCAGAGATGAAGTCAGG - Intronic
1115380275 14:32729234-32729256 AATTCTGCCCAAATGGAGACTGG - Intronic
1117857127 14:60046776-60046798 CATTCTTCACAGATTTAGAATGG - Intronic
1121058217 14:90878647-90878669 CATTCTGCAGAGCAGAAAACTGG + Intronic
1121182745 14:91941891-91941913 CATGGTGTACACATGAAGACAGG - Intronic
1121870971 14:97406875-97406897 TATTCTGAACAGATAAAAACTGG + Intergenic
1122758420 14:104001261-104001283 GAAGCTGCAGAGATGAAGACGGG - Intronic
1122924388 14:104892929-104892951 GGTTCTGCACAGAGGAAGTCGGG - Intronic
1125239388 15:37556700-37556722 CATTCTGTACAACAGAAGACTGG - Intergenic
1125734498 15:41914481-41914503 TATTCTGCTCAGATCAAAACTGG + Intronic
1126544808 15:49861768-49861790 CCTTCTGAACAGATTAAGAAGGG - Intronic
1128592232 15:68910283-68910305 TATTCTTCACAGATGCAGTCTGG - Intronic
1129695251 15:77737306-77737328 CATTCTGCAGAAAAGGAGACTGG + Intronic
1131462005 15:92624167-92624189 CATTCTGCAAGGAAGAGGACTGG + Intronic
1132344406 15:101099623-101099645 CAGTCAGCACAGAAGAAGAGGGG - Intergenic
1133406032 16:5525204-5525226 GACCCTGCAAAGATGAAGACCGG - Intergenic
1136590762 16:31216477-31216499 CTTTCTTCGCAGATAAAGACGGG - Intronic
1137508416 16:49076845-49076867 GATGCTGCAGAGATGAGGACTGG - Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1138976062 16:62209509-62209531 CATTCTACACATAGGAAAACAGG - Intergenic
1139920541 16:70457201-70457223 CACTATGCTGAGATGAAGACTGG + Intronic
1141026753 16:80556021-80556043 CATTCTTCACATTTGTAGACAGG - Intergenic
1143561479 17:7698230-7698252 CATTCTGTACACATGTAGAAGGG - Intronic
1144159239 17:12541242-12541264 GATACTGCACAAAAGAAGACAGG - Intergenic
1144184042 17:12779525-12779547 CATTTTGCAGAGCTGAAGAAAGG - Intergenic
1145021312 17:19433600-19433622 AAATCTGCACTGATGAAGCCAGG - Intergenic
1146364184 17:32206102-32206124 CATTCTGCAGATAAGGAGACGGG - Intronic
1146485004 17:33235641-33235663 CCTTCTGCAAAGACGTAGACAGG - Intronic
1150929259 17:69566313-69566335 AATTCTGTCCTGATGAAGACAGG + Intergenic
1151745695 17:76010540-76010562 CCTTCTGCAGAGAGGAAGAAGGG + Exonic
1151917835 17:77131695-77131717 CATTCTGGACAAATGAAGTTGGG + Intronic
1154283552 18:13030769-13030791 CATTCTACAATGATTAAGACTGG - Intronic
1155518645 18:26647603-26647625 CAGTCTGCACAAATGAAGTTTGG - Intronic
1157955966 18:52098154-52098176 AATTCTGCATATATGAAGATGGG + Intergenic
1163875417 19:19863699-19863721 ATTTCTGCACAGATGAGGACAGG + Intergenic
1166459315 19:42972323-42972345 AATTCTGCACGGATGCAGCCAGG + Intronic
1166731106 19:45059528-45059550 GTTTCTGCACAGATGAAGTGGGG - Intronic
1167055625 19:47110305-47110327 CTTTCTTCAAAGATGAAGGCTGG + Intronic
926034900 2:9629030-9629052 CATTCTGATGAGATGAAGAAAGG + Intronic
926654243 2:15382871-15382893 AGTTCAGCAGAGATGAAGACAGG + Intronic
926821905 2:16861035-16861057 AAATCTGCACAGTTGTAGACTGG + Intergenic
926936158 2:18088188-18088210 CATTTGGCTCAGATGAAGATTGG - Intronic
927381750 2:22487376-22487398 CATTCTCCACAGAGGGTGACAGG + Intergenic
927940077 2:27097967-27097989 CATTCTGCAGAGGAAAAGACTGG - Intronic
932018915 2:68062862-68062884 CAGTCTGCCCAGAGGATGACAGG + Intronic
933369174 2:81393558-81393580 GAATCTGCATAGATGAAGCCAGG - Intergenic
936151834 2:110025980-110026002 CCTTCTGCACAGAAGTAGCCAGG + Intergenic
936192840 2:110345389-110345411 CCTTCTGCACAGAAGTAGCCAGG - Intergenic
936986100 2:118312365-118312387 CAATCTACACAGATGAAGACAGG + Intergenic
937319486 2:120952508-120952530 CCTTCTGCACATTTGAAAACTGG - Intronic
939321356 2:140627396-140627418 CATTCAGCACAGAAGAAAAATGG - Intronic
941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG + Intergenic
942211150 2:173671591-173671613 CATTCTGTAATGATGAAGTCCGG - Intergenic
944959938 2:204860862-204860884 TAATCTGCACATATGAAGCCTGG - Intronic
945053537 2:205848430-205848452 AATTCTGCACAGATAAAACCAGG + Intergenic
946522055 2:220476632-220476654 GATGCTGAACAGATGAAAACTGG - Intergenic
947883947 2:233547773-233547795 TCTTGTGCACATATGAAGACAGG + Intronic
948457914 2:238115585-238115607 CATTCTCTACAGATAAATACAGG - Intronic
948911082 2:241003013-241003035 CACTCTGCACAGAGGAGGGCAGG - Intronic
1169645696 20:7807118-7807140 CATTCTCCACAAAGGAACACAGG - Intergenic
1169869298 20:10234244-10234266 CATTTTGCAGATATGAAAACTGG + Intronic
1171088419 20:22261422-22261444 CATTTGGTACAGATGAAGGCTGG + Intergenic
1174136595 20:48384508-48384530 CTTTCTGTACAGATGAAACCTGG + Intergenic
1178368472 21:32007411-32007433 CATTCTGCACAGATGAAGACAGG - Intronic
1181912035 22:26246049-26246071 TATTCTACACATATCAAGACAGG + Intronic
1183006931 22:34911319-34911341 CATTCTCCACATAAGGAGACGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949211835 3:1512262-1512284 CATTTTGCAGAGGTGAAAACTGG - Intergenic
950026553 3:9824265-9824287 TATTAGGCACAGATTAAGACAGG + Intronic
950172527 3:10848962-10848984 GATACAGAACAGATGAAGACTGG - Intronic
953715612 3:45314731-45314753 CATCCTGCAGACATGAGGACAGG + Intergenic
955003549 3:54949084-54949106 CAATCTGCTCAGATGAATACTGG - Intronic
956675654 3:71729540-71729562 CAGTCTCCACATATGAGGACTGG + Intronic
958143793 3:89598145-89598167 GATTGGGAACAGATGAAGACTGG - Intergenic
961199195 3:125030693-125030715 CATTGCACAAAGATGAAGACAGG + Intronic
961406434 3:126682871-126682893 CATTCTGCACAAGTGCAGTCGGG + Intergenic
961788243 3:129360269-129360291 CAATCTACACAGATAAAGCCAGG - Intergenic
962100187 3:132333765-132333787 TTTTCTGCAGAGATAAAGACTGG + Intronic
966249997 3:177854594-177854616 AATTCTGTACAGCTGAAGAATGG + Intergenic
966429347 3:179814982-179815004 CTTTCTGCACAAGTGAAGCCAGG - Intronic
969351211 4:6598986-6599008 GATCCTGGACAAATGAAGACAGG + Intronic
976098822 4:81538563-81538585 CATTATGCAAAGATAAAGAGGGG - Intronic
977924357 4:102683117-102683139 CAATTTGCAAAGATGAAGACAGG + Intronic
981091077 4:140732985-140733007 CAGTCTGCAGTGATGAGGACTGG - Intronic
981710210 4:147701605-147701627 GAATCTGCACAGTTGAAGGCTGG + Intergenic
982366945 4:154589437-154589459 CCTTCTGCTCTGATGAAGACTGG - Exonic
984958299 4:185068249-185068271 CAATCTACCCAGATGAAAACTGG - Intergenic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
988571623 5:32373077-32373099 TATTCTGCACAGTTGAAGGAGGG - Intronic
989378416 5:40789836-40789858 CATTCTGCACTGATCAAATCAGG - Intronic
993445221 5:88003671-88003693 CATTCTTCACAGAACTAGACAGG + Intergenic
995747293 5:115417358-115417380 TATACTACACAGATGAAGAGTGG - Intergenic
995940903 5:117582731-117582753 GCTCCTGCCCAGATGAAGACAGG - Intergenic
996184186 5:120456708-120456730 CATTTTATACAGTTGAAGACAGG + Intergenic
998985129 5:147748546-147748568 AAGTTTGCACAGATGAATACTGG + Intronic
999269653 5:150289446-150289468 CCTTGTACACAGATGAAGGCAGG - Intronic
1002699129 5:181110101-181110123 CATTCTCCACTGATGGACACTGG - Intergenic
1003891064 6:10564214-10564236 CATTTTGCAAATATGAAGACGGG + Intronic
1004251847 6:14029318-14029340 AAGTCTGCACAGGTGAAGAAAGG + Intergenic
1010007681 6:71013134-71013156 CATTCTGCTCAGAATATGACTGG - Intergenic
1012717001 6:102687348-102687370 CATTAGGCACAGACAAAGACTGG - Intergenic
1014993254 6:128108555-128108577 AATTCTGGCCAGGTGAAGACAGG - Intronic
1017450453 6:154550003-154550025 CATTCTGCAAAGGTGAATTCAGG + Intergenic
1019059465 6:169245243-169245265 CATTTTACAAAGATGAAGGCTGG - Intronic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1023150881 7:37200525-37200547 CATTCGTCACAGGTGAAGAGAGG - Intronic
1023162795 7:37313604-37313626 CGTTCTTCCCAGATGAACACTGG - Intronic
1024530044 7:50383959-50383981 CATTCTGCACAGAAGACCTCAGG + Intronic
1026126989 7:67587729-67587751 CATTCTACACATAAGAAGAATGG - Intergenic
1028271987 7:88802956-88802978 AATTATGCACAGTTGCAGACTGG - Intronic
1029545417 7:101207823-101207845 TGTTCTGCACAGAGGAACACAGG - Intronic
1029643821 7:101838833-101838855 CAGTCTGGACAGATTAACACAGG - Intronic
1031775370 7:125902337-125902359 CAGTCTTCCCAGGTGAAGACTGG - Intergenic
1032085370 7:128880829-128880851 CATTCTTCACAGTTCAAGAGGGG + Intronic
1032779497 7:135152477-135152499 CATTTTCCAGAGAAGAAGACAGG - Intronic
1033896741 7:146080741-146080763 CATCATGCACAGCTGAAGAGTGG - Intergenic
1035386232 7:158474914-158474936 CATCCTGGACAGCTGAAAACAGG + Intronic
1037680295 8:21091826-21091848 TAGTCTGGACAGATGAAGCCTGG + Intergenic
1039878019 8:41603879-41603901 CATTCTGTGCAGCTGAGGACTGG - Intronic
1040466344 8:47699110-47699132 AAATCTGCCCAGTTGAAGACAGG - Intronic
1041207297 8:55511718-55511740 CATTCTGCACAGGTAAATAATGG + Intronic
1042309469 8:67366061-67366083 CATCCTTCACAAATTAAGACAGG - Intergenic
1043806587 8:84679759-84679781 GATTCAGCACTGATGAAGCCAGG + Intronic
1047225338 8:122951832-122951854 CATTCTGCACACACGTAGAGGGG - Exonic
1048139762 8:131782862-131782884 GATCCTGCACAGATGGGGACAGG - Intergenic
1048794734 8:138139293-138139315 CATCCTGCAAAAATGATGACAGG + Intronic
1049915872 9:318154-318176 CAGTCTGCAGAGACGAAGAGAGG - Intronic
1052103491 9:24480819-24480841 GCTCCTGCCCAGATGAAGACAGG - Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052789678 9:32863630-32863652 CATTTTGCACTGATGAAGATAGG + Intergenic
1054847995 9:69817284-69817306 AATTGAGCACAGATCAAGACAGG + Intergenic
1054945785 9:70794598-70794620 GATTCTGCCCAGATGCAAACAGG - Intronic
1054996876 9:71401376-71401398 TAGTCTGCTCAGATGAACACTGG - Intronic
1055971807 9:81919282-81919304 TATTCTGCACAGATGATGACAGG - Intergenic
1055973559 9:81934354-81934376 TATTCTGCACAGATGATGACAGG - Intergenic
1055980355 9:81994610-81994632 TATTCTGCACACATGATGACAGG - Exonic
1058901699 9:109447755-109447777 CATTGTGCACAAGGGAAGACTGG - Intronic
1059492634 9:114681847-114681869 CATTCAGCACAGGTGGAGACTGG + Intergenic
1060011227 9:120044424-120044446 CAGTCTGCTCATATGAAAACAGG + Intergenic
1193184473 X:78495943-78495965 CATTCTGCAAAGACAAAAACAGG - Intergenic
1193476685 X:81974648-81974670 CATTCTCCACAAATTAACACAGG + Intergenic
1194833202 X:98650660-98650682 CAGCCTGAACAAATGAAGACGGG + Intergenic
1195851096 X:109282221-109282243 TATTCTACACAGATTCAGACAGG - Intergenic
1199119477 X:144034526-144034548 AATTATCAACAGATGAAGACTGG + Intergenic
1200376818 X:155790243-155790265 CATTGTGTACTGATGAAGTCTGG - Intergenic