ID: 1178368927

View in Genome Browser
Species Human (GRCh38)
Location 21:32010979-32011001
Sequence CTGAATACATAAATGGACGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 1, 2: 5, 3: 49, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178368927_1178368931 -4 Left 1178368927 21:32010979-32011001 CCGTCGTCCATTTATGTATTCAG 0: 1
1: 1
2: 5
3: 49
4: 263
Right 1178368931 21:32010998-32011020 TCAGTGTCTTACAGGAGTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 208
1178368927_1178368930 -7 Left 1178368927 21:32010979-32011001 CCGTCGTCCATTTATGTATTCAG 0: 1
1: 1
2: 5
3: 49
4: 263
Right 1178368930 21:32010995-32011017 TATTCAGTGTCTTACAGGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 162
1178368927_1178368932 -3 Left 1178368927 21:32010979-32011001 CCGTCGTCCATTTATGTATTCAG 0: 1
1: 1
2: 5
3: 49
4: 263
Right 1178368932 21:32010999-32011021 CAGTGTCTTACAGGAGTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 131
1178368927_1178368933 23 Left 1178368927 21:32010979-32011001 CCGTCGTCCATTTATGTATTCAG 0: 1
1: 1
2: 5
3: 49
4: 263
Right 1178368933 21:32011025-32011047 TCTTCTCACTCATGTCTGCCTGG 0: 1
1: 0
2: 3
3: 23
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178368927 Original CRISPR CTGAATACATAAATGGACGA CGG (reversed) Intronic
900271728 1:1793632-1793654 CTGAATGAGTAAATAGACGAGGG - Intronic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
907485562 1:54775617-54775639 CTGAATACATAAAATTAGGATGG - Intergenic
907774906 1:57504549-57504571 TTGGATACATAAATGAATGAGGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
910552513 1:88492134-88492156 CTGATTAGAGAAATAGACGAAGG + Intergenic
910582630 1:88845560-88845582 CTGATTACTTAAAGGGAGGAGGG - Intergenic
912380278 1:109243861-109243883 ATGAATACATGAATGGAGGATGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
917024167 1:170624111-170624133 CTTAATATATAAATGGATGAAGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917940368 1:179914050-179914072 CTGAATACATAAACTTACGTCGG - Exonic
918520191 1:185406762-185406784 CTAAATGCATAAATGGACAGGGG + Intergenic
918580573 1:186122455-186122477 ATGAATACATAAATAGATCATGG - Intronic
918624707 1:186644110-186644132 CTGAACAGATAAATGAATGAGGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919002729 1:191854217-191854239 CTGCATACAAAATTGGAGGACGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
923185850 1:231572547-231572569 TTGAATACATAAATTCACAAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1068487969 10:57683712-57683734 ATGAATAAATAAATGTATGAGGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069314914 10:67086120-67086142 ATGGATAGATAAATGGATGAAGG + Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070501498 10:77076889-77076911 CTGATTTCATAATTGGACAACGG - Intronic
1070678485 10:78432591-78432613 CTGAATAAATAAATAAATGAAGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1073543429 10:104330181-104330203 CTGAATACATGAATGGAGTTAGG + Intronic
1073660173 10:105466900-105466922 CTAAATACATAATTGGGGGAGGG - Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1076341352 10:129748209-129748231 CTGAATACAGAAATAGGTGAGGG - Intronic
1077730518 11:4724316-4724338 CTGAAAACAGAAGTGGAAGATGG + Intronic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1079704971 11:23604036-23604058 ATGAATAGATAAATGAATGAAGG - Intergenic
1080955229 11:37085873-37085895 TTGAATAAATAAATGAATGAGGG - Intergenic
1084793758 11:71490928-71490950 CTGGATGCAGAACTGGACGAAGG - Exonic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087578613 11:100023885-100023907 CTGAATAGATAAATGAACTGTGG - Intronic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1090237171 11:125157951-125157973 GTGAATAAATGAATGGATGAGGG + Intergenic
1090361280 11:126174695-126174717 TTGAATATATAAATGAAAGATGG - Intergenic
1090599236 11:128353256-128353278 ATGAATACATTAATGCACCAGGG + Intergenic
1091695724 12:2626907-2626929 ATGAGTAAATAAATGGACGAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098982165 12:76968328-76968350 CTGAATATATAAATGAATGTAGG + Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1101043812 12:100784146-100784168 TTGAATGCATTAATGAACGAAGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102222956 12:111206947-111206969 ATGAATGCATAAATGGATGGTGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104469131 12:129014971-129014993 TTGGATACATACATGGATGAAGG - Intergenic
1105786535 13:23755323-23755345 CTGAATAAATGAATGGCTGAAGG + Intronic
1105786537 13:23755363-23755385 CTGAATAAATGAATGGCTGAAGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109622931 13:64932502-64932524 CTAAATTCGTAAATGGATGATGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1111118954 13:83821685-83821707 CTGAATACATTAAATGACCATGG - Intergenic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1113024847 13:105929176-105929198 CTGAATTCATAAAAGAATGATGG + Intergenic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1126293208 15:47105993-47106015 CTGGAGACATAAATAGAGGAAGG - Intergenic
1128365122 15:66994246-66994268 TTGAAAACATAAATGGGCAAAGG + Intergenic
1128785291 15:70391970-70391992 CTTAATAGATAAATGGGTGATGG + Intergenic
1129415111 15:75372143-75372165 CTGGGTAGATAAATGGACCAAGG - Exonic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1131783485 15:95885332-95885354 ATGACTTCATAAATGGACGGTGG - Intergenic
1131825034 15:96313801-96313823 CTGAATACTTAAAACAACGATGG - Intergenic
1131953000 15:97701992-97702014 TTGAAAGCATAAATGGACCAGGG + Intergenic
1133435861 16:5778959-5778981 ATGAATAGATCAATGGATGAGGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133527066 16:6615995-6616017 CTGAATCCATATATAGACGCAGG + Intronic
1137569442 16:49555752-49555774 GTGAATAAATAAATGGATGGAGG + Intronic
1137718346 16:50612524-50612546 ATGAATACATAAATCTGCGAAGG + Intronic
1139190954 16:64862256-64862278 CTGAACTCATAAATGGATTATGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1143714017 17:8754157-8754179 ATGAATACATGAATGAATGAAGG + Intronic
1145913674 17:28557587-28557609 CTGAATGAATAAATGAACGGAGG + Intronic
1147441973 17:40452975-40452997 CTGAATACAGACAAGGACGAGGG + Exonic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151212579 17:72555593-72555615 ATGAATAAATAAATAAACGAGGG + Intergenic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156088468 18:33438026-33438048 CTGAAAATATAAAGGGACTATGG + Intronic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157316383 18:46593477-46593499 TTGAAGACAAAAATGTACGATGG - Intronic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159685724 18:71417550-71417572 CTGAATGCTTAAATGAACGCTGG - Intergenic
1159726768 18:71970503-71970525 TTGAATACATAAATAAATGAAGG + Intergenic
1160276293 18:77440313-77440335 CTCAATACATAAGTGTATGAAGG + Intergenic
1160574880 18:79847577-79847599 CTTATTACATACATGGATGAGGG - Intergenic
1161934503 19:7363323-7363345 GTGAATGGATAAATGGATGATGG + Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1164522034 19:28986844-28986866 CTGAATACATAAATAAATGAGGG + Intergenic
1165867574 19:38948446-38948468 ATGAATAAATAAATGGGGGAAGG + Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927260334 2:21081903-21081925 CTCAATATATAAATGGCAGAGGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
930500702 2:52213918-52213940 CTGAATCCATAAATGGCAGGTGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932978267 2:76630477-76630499 ATAAATACATAAATAGATGAAGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
936350057 2:111705782-111705804 CTGAATACCTAACTGGAATAAGG - Intergenic
936732565 2:115401592-115401614 ATGAATAGATAAATAGACGCAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938259745 2:129887073-129887095 CTGAATTCCAAAATGGATGAGGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
942539704 2:177002874-177002896 ATGAATACATAAGGAGACGATGG + Intergenic
942590277 2:177536960-177536982 CTGAATACTTTAATGAAAGAAGG + Intronic
943720086 2:191194814-191194836 ATGGATAGATAAATGGAAGAAGG - Intergenic
944665590 2:201956416-201956438 ATGAAGACTTAAATGGACCATGG - Intergenic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946643840 2:221812943-221812965 CTGAACACATAAATGCATGATGG - Intergenic
947037595 2:225876733-225876755 TTGAATACATAAATGAATTAAGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171804936 20:29668581-29668603 CTGGAGACATAAATAGAGGAAGG - Intergenic
1171839123 20:30187847-30187869 CTGGAGACATAAATAGAGGAAGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173896876 20:46557845-46557867 TTGAATGAATAAATGGAAGAAGG + Exonic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1175452552 20:59082103-59082125 AAGAATACATAAACGGACAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176153355 20:63604947-63604969 CTGAATTCAGAAATGGCAGAGGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177868132 21:26537350-26537372 CAGAACACATAAAGGGATGATGG + Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178629344 21:34245676-34245698 CTGATTCTATACATGGACGATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179072556 21:38085320-38085342 CTGAATAAATAAATAGATGGGGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182766530 22:32761731-32761753 GTAAATAAATAAATGGAGGAAGG - Intronic
1184026376 22:41860266-41860288 CTGATAGCAAAAATGGACGAAGG + Intronic
949332977 3:2942861-2942883 CAGAATACATCAAGGGACTAGGG + Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
952433094 3:33245015-33245037 CTGAATACATAAATAAATTAGGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956807446 3:72829505-72829527 ATAAATACATAAATGAAAGAAGG + Intronic
959176195 3:102914232-102914254 GTGAATACATAAAAGGAGGGAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
964898346 3:161625623-161625645 CTGAATATATAAGTTGAAGAAGG + Intergenic
965094725 3:164210439-164210461 CTGGTTACAGAAATGGACGGTGG - Intergenic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967382121 3:188870414-188870436 TTAAATACATAAATGAATGAGGG - Intronic
967694949 3:192519755-192519777 CTGAATACATAAATAAATGTAGG - Intronic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
975885109 4:78955944-78955966 CTAAATACTTAAATGTACTAAGG + Intergenic
976660460 4:87535263-87535285 AGGAATACATAAGTGGACAAGGG + Intergenic
976991547 4:91373534-91373556 CTGAATACATAAATGTTCTGTGG + Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977829343 4:101571866-101571888 CTGAATGAATAAATGAATGAAGG + Intronic
978878179 4:113667298-113667320 CTGAATAAATGAATGAAGGATGG + Intronic
980639074 4:135550654-135550676 CTGAATAAATAAAGGTAGGATGG - Intergenic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
983435999 4:167716246-167716268 GTGAATACATAAATAAATGAAGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
988026114 5:25692512-25692534 CTGCAAGCATAAATGGACCATGG + Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989572576 5:42958357-42958379 CTGTATATATCAATGCACGATGG + Intergenic
990311714 5:54546342-54546364 ATGAAGACATAAATGGAAAATGG - Intronic
990841384 5:60083206-60083228 CTGAATAAATAAATGAACTCAGG + Intronic
990966481 5:61454051-61454073 TTGAATAAATAAATGGGGGAAGG - Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993147437 5:84113172-84113194 CTGAATACAAAAATAGAATACGG + Intronic
995482245 5:112604871-112604893 CTGAATTCAGAAATGGTGGAGGG + Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997078854 5:130714821-130714843 CTCAATAAATTAATGGATGATGG + Intergenic
999854503 5:155579525-155579547 ATGAATGCATGAATGGATGATGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1001326438 5:170730990-170731012 CTGAATACATAAATAAATGCAGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004233028 6:13850032-13850054 CTGAATATATAAACAGATGATGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004549773 6:16635787-16635809 CTGAAAACATGAGTGGAGGAAGG + Intronic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1011114034 6:83870474-83870496 CTGAAAACAGAAATGAACCAAGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012205797 6:96458911-96458933 CTGAATTCCAAAAGGGACGAGGG + Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017275745 6:152565954-152565976 CTGACTACATACATGGGTGATGG + Intronic
1017783403 6:157734107-157734129 ATAAATACATAAATGAATGATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018630747 6:165819819-165819841 ATGAATACATGAATGAATGATGG + Intronic
1018646300 6:165951822-165951844 TTGAATGAATAAATGGAAGAAGG - Intronic
1019870730 7:3758365-3758387 TTGAATATATAAATGGGAGATGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1023130850 7:37001602-37001624 CTGAATAAATAAAAGGGAGATGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024356461 7:48418060-48418082 ATGAATAGATAAATAGACTATGG - Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG + Intergenic
1026696958 7:72603437-72603459 CTGAATACATTAATAAATGAGGG + Intronic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029084081 7:97997737-97997759 CCGAAGATAAAAATGGACGATGG - Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034883616 7:154780886-154780908 ATGAATAGATAAATGCATGATGG + Intronic
1038120468 8:24608692-24608714 ATGAATGAATGAATGGACGAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040673811 8:49725072-49725094 TTGAACAAATGAATGGACGATGG + Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044964603 8:97562871-97562893 CTGAATGCATAAAGGAACCAGGG + Intergenic
1045102443 8:98858942-98858964 GTGAATAAATAAAAGGACTAAGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047614256 8:126550211-126550233 CTGATTACATTAAGGGAGGAAGG - Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047881439 8:129198539-129198561 ATAAATAAATAAATGGATGAAGG - Intergenic
1047925070 8:129674667-129674689 TTGAATACATAAATTTAAGAAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052220273 9:26013250-26013272 TTGAATACATAAATTGAATAAGG + Intergenic
1052498017 9:29253153-29253175 TTGAATACATAAATTAATGAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056520077 9:87393027-87393049 CTGAATACACAAACAGATGATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059705249 9:116816907-116816929 ATAAATAAATAAATAGACGAGGG + Intronic
1059929055 9:119242694-119242716 CTTAATAGATAAATGAACGGTGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060022797 9:120146716-120146738 CTGAATACAGTAATGCACGTGGG + Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185842285 X:3403058-3403080 ATAAATAAATAAATGGATGAAGG - Intergenic
1186902877 X:14076876-14076898 GAGAAAACATAAATGGATGATGG - Intergenic
1187779914 X:22808902-22808924 TTGAAGAAATAAATGGAAGAGGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1192549532 X:72042866-72042888 TTGAATAAATAAATGAAGGAAGG + Intergenic
1192823307 X:74666991-74667013 CTTAAGAAATAAATGGATGAGGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194178005 X:90675870-90675892 ATGAATAAATAAATATACGAGGG + Intergenic
1194681074 X:96853563-96853585 TTGAATACATTAATGGAAAATGG - Intronic
1194891078 X:99380051-99380073 CTGAATACATAAATGAAGTTGGG - Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1200524673 Y:4258026-4258048 ATGAATAAATAAATATACGAGGG + Intergenic
1201290130 Y:12414667-12414689 CTGAATTCCAAAATGGAGGAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic