ID: 1178369459

View in Genome Browser
Species Human (GRCh38)
Location 21:32015273-32015295
Sequence AAAGCTGATCAGATTGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178369459_1178369462 27 Left 1178369459 21:32015273-32015295 CCTAAAACAATCTGATCAGCTTT 0: 1
1: 0
2: 3
3: 27
4: 237
Right 1178369462 21:32015323-32015345 AACAATGTCACTGATGTTAAAGG 0: 1
1: 0
2: 1
3: 20
4: 259
1178369459_1178369461 -10 Left 1178369459 21:32015273-32015295 CCTAAAACAATCTGATCAGCTTT 0: 1
1: 0
2: 3
3: 27
4: 237
Right 1178369461 21:32015286-32015308 GATCAGCTTTCTGCTTTTGTGGG 0: 1
1: 0
2: 4
3: 24
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178369459 Original CRISPR AAAGCTGATCAGATTGTTTT AGG (reversed) Intronic
902309187 1:15567871-15567893 AATGCTTATCATATTGGTTTGGG - Exonic
902851856 1:19164863-19164885 CCAGCTGATCAGAATCTTTTGGG + Exonic
904360595 1:29969097-29969119 AGAGCTGAGAAGAGTGTTTTGGG - Intergenic
904966438 1:34378043-34378065 AAAGCTGATAAGAATGTTAGGGG - Intergenic
905104484 1:35556516-35556538 AAAAATGAACAGATTGTTCTGGG + Intronic
905262269 1:36728226-36728248 GCAGCTGATTAGATTGTTATTGG - Intergenic
905984800 1:42270175-42270197 AAAACTGAGTAGATTGATTTAGG - Intronic
907039116 1:51242224-51242246 AGAATTTATCAGATTGTTTTGGG + Intronic
908054026 1:60263672-60263694 AAATATGATCAGAGTGTCTTGGG - Intergenic
909071607 1:71000673-71000695 AAAGATTATCAGATAGGTTTGGG + Intronic
909213214 1:72850665-72850687 AAAGATGAACAGACTCTTTTTGG - Intergenic
910571677 1:88712398-88712420 ATATCTGATCAGACTGTTTTAGG + Intronic
911553859 1:99318335-99318357 AAAGCAGATCCTATTTTTTTTGG + Intergenic
911608318 1:99933354-99933376 ATATCTGAACTGATTGTTTTGGG - Intergenic
912216775 1:107622921-107622943 AAAGATGAACACACTGTTTTTGG + Intronic
912905209 1:113698746-113698768 AATGCTGACCTGATGGTTTTGGG - Intronic
912911968 1:113770490-113770512 AAAGTTTATCAGGATGTTTTTGG - Intronic
913465871 1:119141967-119141989 AAAGCTGATCAGTTTGGTTTTGG + Intergenic
914449822 1:147781186-147781208 AAAGGAAGTCAGATTGTTTTCGG + Intergenic
915708033 1:157865173-157865195 AAAGCTGACCGCATTCTTTTTGG - Intronic
916023381 1:160813945-160813967 ACAGCTGCTCATATTGTTTCTGG - Intronic
916277223 1:163008005-163008027 CAATCTGATCATATAGTTTTAGG - Intergenic
918334978 1:183500386-183500408 AAAACCTTTCAGATTGTTTTTGG + Intronic
918816804 1:189196550-189196572 AAAGGTGAGTAGTTTGTTTTGGG - Intergenic
921363242 1:214350024-214350046 AAAGCTGAAAAGATTGGATTGGG - Exonic
921473022 1:215570625-215570647 CAATCTTATCAGATTGTTATAGG + Intronic
922146420 1:222949996-222950018 AAAGATGATCAGCTAGGTTTAGG - Intronic
922611768 1:226935639-226935661 AAACCTGACTAGATTGCTTTAGG + Intronic
923373185 1:233333166-233333188 ATAGCTCATCAGAGTGATTTGGG + Intronic
923570453 1:235108502-235108524 AAAGCTTATAAGTTTGTGTTGGG - Intergenic
923670436 1:236036058-236036080 AATGCTGAACAGTTTGTGTTTGG - Intronic
1063714984 10:8517902-8517924 AATTCTGATTCGATTGTTTTGGG + Intergenic
1066076072 10:31878409-31878431 AAAGCTGATCAGTTAGTGTAAGG - Intronic
1067997866 10:51295923-51295945 TGAGATGATCATATTGTTTTTGG + Intronic
1069136022 10:64766720-64766742 AATGCTGTTCTGATTTTTTTCGG - Intergenic
1069161123 10:65093578-65093600 AAGGCTTTTCAGAATGTTTTGGG + Intergenic
1073230964 10:101969706-101969728 GAAGCTGAACAGATTGTTCTGGG + Intronic
1073519357 10:104112310-104112332 AAAGCTTAGCAGATTTTTTTTGG - Intergenic
1073955292 10:108863870-108863892 AAAGATTATCTGTTTGTTTTAGG - Intergenic
1074094558 10:110299223-110299245 AAAGCTGCTTAAAGTGTTTTGGG - Intronic
1074138967 10:110654470-110654492 ACTGCTCATCAGATTTTTTTGGG + Intronic
1074184219 10:111087035-111087057 GGACCTGATCAGATTTTTTTTGG + Intergenic
1075646572 10:124100742-124100764 AAACCACATCAGAGTGTTTTGGG - Intergenic
1078004314 11:7520997-7521019 AAAGCTAAACAGATTATTCTAGG - Intronic
1080567435 11:33525014-33525036 AAAGTTGACCAGATTTTTATAGG + Intergenic
1080823919 11:35832099-35832121 AAAGCTGATGAGCCTATTTTTGG - Intergenic
1086140693 11:83495658-83495680 TAAGCTGAAAATATTGTTTTGGG - Intronic
1087422929 11:97954108-97954130 AAAGTGAATCAGATCGTTTTTGG + Intergenic
1087873222 11:103325502-103325524 AAAGATCGTCAGATTGTTGTAGG + Intronic
1088284768 11:108176136-108176158 GAAGTTGTTCAGATTGTTATAGG - Intronic
1090785318 11:130043089-130043111 AAAACTGATCAGATATTTATGGG + Intergenic
1091782464 12:3222592-3222614 GACGCTGATCAGATTGTGTGGGG + Intronic
1091942663 12:4502445-4502467 CAAGCTGATGAGATTTTTCTTGG - Intronic
1094430204 12:30360129-30360151 ACAGGTAATCAGATTGCTTTTGG + Intergenic
1096481883 12:51947563-51947585 TAAACTGATCATATTGTGTTAGG - Intergenic
1097317020 12:58182327-58182349 AAAGGTTATGAGATTGTATTAGG + Intergenic
1097371048 12:58781718-58781740 AAAACAGAGCAGAGTGTTTTTGG - Intronic
1098323256 12:69273234-69273256 AACACTGTTCAGATTGATTTAGG + Exonic
1098652898 12:72995952-72995974 AAAGCTGAGGAGAATATTTTTGG - Intergenic
1099040774 12:77651892-77651914 AAATCTGGTCAGCTTGTGTTTGG + Intergenic
1099091201 12:78311473-78311495 AGAAATGATCAGATTGTTTTGGG + Intergenic
1100893275 12:99150178-99150200 AAAGCACAACAGATTGTTGTAGG - Intronic
1103351560 12:120287326-120287348 AACACTGAGCAGATTGTTTAGGG + Intergenic
1105508049 13:21027802-21027824 AAACCTGCTGAGATTGTATTTGG + Intronic
1105617540 13:22033052-22033074 AAGGCTGATAAGAGTGTGTTTGG + Intergenic
1107061966 13:36169136-36169158 AAATCATTTCAGATTGTTTTAGG - Intronic
1107257542 13:38446709-38446731 AAAGCTGTTGAAACTGTTTTAGG - Intergenic
1107367705 13:39702289-39702311 AAAGCTTCCCAGTTTGTTTTAGG + Intronic
1107371418 13:39753950-39753972 AAAGCTTATCAGGTTAGTTTCGG - Intronic
1107494912 13:40916867-40916889 AAATCTCAGCAGATGGTTTTCGG - Intergenic
1108863615 13:54894608-54894630 AGAGCTGATGAGATTGATTGAGG - Intergenic
1109328005 13:60893249-60893271 AAACCTGTTGAGATTGTTCTTGG - Intergenic
1109591313 13:64486825-64486847 AAAGCTGATCAAATTACTTCTGG - Intergenic
1113113819 13:106853385-106853407 AAAGCTGATGTGATTGTCTGGGG + Intergenic
1113451356 13:110412337-110412359 AAAGATTTTGAGATTGTTTTGGG - Intronic
1113566345 13:111321958-111321980 AAAACAAATTAGATTGTTTTGGG + Intronic
1114039650 14:18665287-18665309 AAAGCTGTTGAGATTTTTATTGG + Intergenic
1115205950 14:30904430-30904452 AAAGGTGACCAGTTTGTCTTGGG - Intronic
1115401426 14:32965450-32965472 TGAGATGATCAGATGGTTTTTGG - Intronic
1117661528 14:58010724-58010746 AAAGCTGTACAGATTTTTTTAGG + Intronic
1117794399 14:59377239-59377261 AGAGTTAATCAGAGTGTTTTAGG - Intergenic
1118161603 14:63296459-63296481 AACACTGATCAGATTCTGTTTGG - Intergenic
1119459228 14:74785262-74785284 AATGATGATTATATTGTTTTAGG + Intronic
1121471865 14:94162104-94162126 AAAACAGATTAGCTTGTTTTTGG - Intronic
1121482142 14:94287354-94287376 AAAGGTGATCACAAAGTTTTTGG - Intronic
1121815117 14:96923359-96923381 AAAGTTTATCAGAAAGTTTTAGG - Intronic
1122390846 14:101382212-101382234 AGAGCTCATCAGATTGTATTTGG - Intergenic
1123663282 15:22585528-22585550 AAAAATGAGCATATTGTTTTTGG - Intergenic
1123959579 15:25382828-25382850 AAAGGTTATCAAATTTTTTTGGG - Intronic
1124317111 15:28679966-28679988 AAAAATGAGCATATTGTTTTTGG - Intergenic
1127077825 15:55345298-55345320 AATGCTTAACTGATTGTTTTTGG - Intronic
1131494849 15:92899227-92899249 AAAGTTGATTGGATTTTTTTGGG + Intronic
1133380743 16:5328251-5328273 AACGCTGATCAGATTGGATTAGG - Intergenic
1133539437 16:6734885-6734907 AAAGGTTATCAGAATGTATTAGG + Intronic
1134328577 16:13229575-13229597 AATTCTGATCAAATGGTTTTGGG + Intronic
1139223233 16:65206462-65206484 AAAGCTAATCAACTTGTATTAGG - Intergenic
1144663816 17:17088738-17088760 TCAGCTCATCAGACTGTTTTTGG - Intronic
1145875229 17:28314326-28314348 ACAGCTGGACAGAATGTTTTTGG + Intergenic
1146279347 17:31535303-31535325 AAAGCTGAGCCCACTGTTTTAGG - Exonic
1150270193 17:63859172-63859194 ATTGCTGATCAGATGGTTTAAGG + Intergenic
1150299954 17:64039567-64039589 AAAGCACATCAGATTTGTTTTGG - Exonic
1152346042 17:79752471-79752493 AAACGTCATCAGATTGCTTTTGG + Intergenic
1153360648 18:4192547-4192569 AAGGCTGATAAAATTGTGTTTGG - Intronic
1155035709 18:22023192-22023214 AGAGCTGCTCAGATAGCTTTAGG - Intergenic
1155349184 18:24889697-24889719 AAAGATGATGAGTTTGGTTTTGG + Intergenic
1155718850 18:28984972-28984994 ATGGCTGATTAAATTGTTTTTGG + Intergenic
1156894549 18:42230446-42230468 ACAGCTAATCACCTTGTTTTTGG - Intergenic
1158146250 18:54316337-54316359 AAAGCTTATGAGATTTTATTAGG - Intronic
1163339295 19:16694398-16694420 AAAGCTGATCAGCATGTGGTTGG + Intergenic
1163893576 19:20038137-20038159 ACACCTTATCAGAATGTTTTTGG - Intronic
1164003457 19:21128155-21128177 AGATCTTATCAGAATGTTTTTGG - Intergenic
1164101058 19:22054736-22054758 AGATCTTATCAGAATGTTTTTGG + Intronic
1164253900 19:23510414-23510436 ATATCTTATCAGAATGTTTTTGG - Intergenic
1164316133 19:24089435-24089457 ATATCTTATCAGAATGTTTTTGG + Intronic
1166993849 19:46709773-46709795 AAAGCAGATCAGAGACTTTTCGG + Intronic
1168581398 19:57558642-57558664 AAAGCTGACCAGAGTCTCTTTGG - Intronic
925959069 2:8998051-8998073 AAAGCTGCCCAAATTCTTTTTGG - Intronic
927055129 2:19359870-19359892 AAAGCTAATCTGATTTTCTTGGG + Intergenic
927336188 2:21927563-21927585 AATGCATATCAGATTGATTTAGG - Intergenic
931381147 2:61754694-61754716 AAAGCTGTTTAGAATGTTTATGG - Intergenic
937286638 2:120758247-120758269 AAAGCTGCTGAGATTGTGTGTGG - Intronic
938270906 2:129970317-129970339 AAAGCTGTTGAGATTTTTATTGG - Intergenic
938739148 2:134214489-134214511 AAAGTTTATCAGTTTGTTTTGGG + Intronic
942389176 2:175474536-175474558 AAAGTAGATCAAAATGTTTTAGG + Intergenic
944415373 2:199474645-199474667 AAGGCTGCTCTGATTGTCTTAGG + Intergenic
944863960 2:203842589-203842611 AACACTTATCAGTTTGTTTTAGG + Intergenic
945552216 2:211234425-211234447 AAAGCTTAGCAGACTATTTTAGG + Intergenic
946533682 2:220604034-220604056 AAATATGGTCAAATTGTTTTAGG - Intergenic
947425789 2:229981878-229981900 AAAGCATAGCAGCTTGTTTTTGG + Intronic
1169022142 20:2338196-2338218 AACAATGTTCAGATTGTTTTTGG - Intronic
1170940061 20:20841444-20841466 AAAGCAGAACTGAATGTTTTGGG - Intergenic
1171223655 20:23422583-23422605 AAAGCTGAGCTGTGTGTTTTTGG + Intergenic
1173484031 20:43427296-43427318 AAAGATGATGAGATTAGTTTTGG - Intergenic
1174537657 20:51264833-51264855 AAAGCTGGTAGGATTGTCTTTGG + Intergenic
1174956833 20:55106654-55106676 GCAGCTGACCAGATTGATTTGGG - Intergenic
1177316969 21:19475202-19475224 AAAGATGTTCAGATTTTTTTAGG - Intergenic
1177936614 21:27355079-27355101 ACAGCTCCACAGATTGTTTTGGG + Intergenic
1178225588 21:30714102-30714124 AAAGCTGAACAGTTGGTTTGTGG - Intergenic
1178369459 21:32015273-32015295 AAAGCTGATCAGATTGTTTTAGG - Intronic
1182203576 22:28599450-28599472 AAAGCTGATCTGATTATGATGGG + Intronic
1182626838 22:31653552-31653574 AAAGCTGAGCTGTTTGTTCTTGG - Intronic
1183129747 22:35822758-35822780 GAAGTTGATCAGAATGTTTGGGG - Intronic
1183880226 22:40820852-40820874 AAAGCTGATCAAAATGTTTTTGG - Intergenic
949429195 3:3955069-3955091 AAAGTTGATCACATTGCTTCAGG - Intronic
950912740 3:16611794-16611816 AAAGCTGATTCCATAGTTTTAGG - Intronic
951688969 3:25375479-25375501 CAAGGTGATCAGTTTCTTTTGGG + Intronic
952094970 3:29939910-29939932 AAAGCTCATGAGATTAGTTTGGG - Intronic
953512015 3:43551573-43551595 AAAGCAGATCATATTTTGTTTGG - Intronic
953942858 3:47116833-47116855 AAATCTCATTAGATTCTTTTGGG + Intronic
956891018 3:73614127-73614149 AAAGCTGAGAAGATTATTTGGGG - Intronic
957817150 3:85315386-85315408 AAAGTTTAGCATATTGTTTTGGG + Intronic
958829099 3:99066284-99066306 AAAGAGGTTCAGATTGTTTGAGG + Intergenic
959384671 3:105688162-105688184 AAAGCTGAACAAATTGTATTTGG + Intronic
959511116 3:107213506-107213528 AATGCTGTTCTGATTGTATTTGG - Intergenic
959523955 3:107355303-107355325 AAAGTTGATGAGTTTGTGTTAGG - Intergenic
960695838 3:120395612-120395634 AAATCTGGTCATCTTGTTTTTGG + Exonic
962725463 3:138221963-138221985 AAAGCCAATCTCATTGTTTTAGG + Exonic
963619187 3:147583599-147583621 AAGGCTGATCACTTTGTTGTGGG + Intergenic
963669705 3:148236182-148236204 AAAGTGGGTCAGATGGTTTTAGG - Intergenic
964431705 3:156613851-156613873 AAACCTGATCAGCCTTTTTTTGG - Intergenic
965299007 3:166986661-166986683 AAAGCTGATCTGAAAGTTTTTGG + Intergenic
966465378 3:180225723-180225745 TGAGCTGATCACTTTGTTTTAGG - Intergenic
966512379 3:180778339-180778361 TAAGATGATCATATGGTTTTTGG + Intronic
968193139 3:196685340-196685362 AAAGCTTATCAATTTGTGTTGGG - Intronic
968216665 3:196897614-196897636 AAAGATGATAAGAGTGTCTTGGG - Intronic
971529583 4:27669524-27669546 CAAACTGATCAGATTCTCTTTGG - Intergenic
974978962 4:68929072-68929094 CAAGGTGAACAGATTATTTTTGG - Exonic
974995270 4:69148420-69148442 CAAGTTGAACAGATTATTTTAGG + Intronic
976738414 4:88333942-88333964 GAAGCTGATGAGATTGCTTAAGG - Intergenic
977100052 4:92799619-92799641 AACACCAATCAGATTGTTTTGGG + Intronic
977499300 4:97819109-97819131 AAAGCTGGTCAGATCAGTTTTGG - Intronic
977830705 4:101588859-101588881 AAAGTTAATCTGAGTGTTTTCGG + Intronic
978362899 4:107949735-107949757 AGAGCTGATCAGGTAATTTTGGG + Intronic
980923369 4:139110275-139110297 TAAGCCCATCATATTGTTTTGGG - Intronic
980977507 4:139625183-139625205 AAAGCTGATAACATTTTCTTGGG + Intergenic
981014830 4:139963060-139963082 AGAGCTCTTCAGATCGTTTTGGG + Intronic
982081589 4:151795530-151795552 AAAGCTTATTGGATTGTTTTTGG + Intergenic
982352502 4:154431094-154431116 AAATCTCAGCAGATTTTTTTGGG - Intronic
982437709 4:155397707-155397729 AAGGCTGATCAGACCATTTTTGG + Intergenic
982776068 4:159442612-159442634 AAAACAGATCAGCCTGTTTTAGG + Intergenic
984299929 4:177902187-177902209 AAAGCTGCTAACATTATTTTTGG + Intronic
984348038 4:178556818-178556840 AAAGCTTATCAAAATGTGTTTGG + Intergenic
985089678 4:186350393-186350415 AAAGATTATAAGATTATTTTTGG + Intergenic
988674398 5:33416892-33416914 AAGTCTCATCAGGTTGTTTTAGG - Intergenic
989414051 5:41152805-41152827 AAAGCTGAATTGATTCTTTTTGG - Intronic
989618550 5:43361782-43361804 GAAGCTGATCAGATAGTTGTAGG + Intergenic
990534763 5:56709830-56709852 TGAGATGATCATATTGTTTTTGG - Intergenic
992943301 5:81784502-81784524 AAAGTTGAACAGTTTGTTTTGGG - Intergenic
993022623 5:82610195-82610217 AAAGGAGATCAGATTGCTTTAGG - Intergenic
993592630 5:89813366-89813388 AAAGCCGAGCTGTTTGTTTTCGG + Intergenic
993697287 5:91076720-91076742 AAAGCTGAACATGTAGTTTTGGG - Intronic
994043079 5:95279917-95279939 AAAGCTACTAACATTGTTTTAGG + Intronic
994442205 5:99822808-99822830 AAAGCAGATAAGATTGGCTTAGG + Intergenic
996045604 5:118869642-118869664 AAATCTGACCAAATTGTTTGTGG - Intronic
996627225 5:125585215-125585237 AAAGCTGCTCTGATTGTATTTGG - Intergenic
997043415 5:130284525-130284547 AAAGCGTTTCAGTTTGTTTTAGG - Intergenic
998613676 5:143716580-143716602 AAAAATGATCATTTTGTTTTAGG + Intergenic
999914810 5:156246530-156246552 TATGCTGAACAGATTGATTTAGG + Intronic
1001754024 5:174152527-174152549 AAAGCTGCTCAGCTTCTTTCTGG + Intronic
1004062664 6:12213321-12213343 AAGGCTGATAAGATAGTCTTGGG - Intergenic
1004320366 6:14627124-14627146 AAAGGAGATAAGATTGGTTTGGG - Intergenic
1007693064 6:43715273-43715295 GAAGCTGAGCAGTTTGCTTTGGG - Intergenic
1008617075 6:53237025-53237047 CAAGCTGATCAGATTTATTTGGG - Intergenic
1009561326 6:65248065-65248087 AAAGATACTCAGATTGTTGTTGG + Intronic
1009742748 6:67768636-67768658 AAAGATGAGCAGATTCTTTTTGG + Intergenic
1009746169 6:67819329-67819351 TTAGATGATCAGATTTTTTTAGG + Intergenic
1010564997 6:77399872-77399894 AAAGCTGACCACATTGCTTAGGG - Intergenic
1010882370 6:81193943-81193965 AAAGCATAAGAGATTGTTTTAGG - Intergenic
1011207697 6:84918091-84918113 AAAACTGATTTGATTCTTTTTGG - Intergenic
1011472718 6:87723851-87723873 AAAGCTGCTCAGCCTGTTGTGGG - Intergenic
1012130548 6:95485836-95485858 AAATCATATCAGATTGTTTTGGG - Intergenic
1014026259 6:116649792-116649814 AAAGCTGATTAGAGTGCTGTAGG - Intronic
1014777235 6:125525266-125525288 AAAGTAGATCAGAGTGTTTTTGG - Intergenic
1016727298 6:147388259-147388281 AAAACTGATCAGTTTATTTAAGG - Intergenic
1017424581 6:154307123-154307145 AAACCATATCAGATTGTATTTGG - Intronic
1017544471 6:155436224-155436246 AAAGCTGAACATAGTGCTTTTGG + Intronic
1018622615 6:165746229-165746251 AAAAATGAACAAATTGTTTTTGG - Intronic
1020960973 7:14800987-14801009 ATAGCTGATCACATGGTTTTAGG - Intronic
1021006427 7:15399846-15399868 AAAGCTGTTCACATTCTTTCTGG + Intronic
1021472662 7:21023481-21023503 AAAGCAGATAAGACTGTCTTGGG + Intergenic
1021556630 7:21925894-21925916 AAAGATCATCAGATTGTGATGGG + Intronic
1021911430 7:25389255-25389277 AGAGCAGTTCAGAATGTTTTGGG - Intergenic
1024880375 7:54078938-54078960 AAAGATGATCAGTTTTCTTTGGG + Intergenic
1025609537 7:63066286-63066308 AAAGCTGATCATCTTGTCTTTGG - Intergenic
1025710449 7:63902902-63902924 AAAGCTGATCATCTCGTCTTTGG + Intergenic
1025788673 7:64667472-64667494 AGATCTTATCAGAATGTTTTTGG + Intronic
1025825204 7:65005343-65005365 AAACCTTATCAGAATATTTTTGG - Intronic
1025865280 7:65375167-65375189 AGATCTTATCAGAATGTTTTTGG + Intronic
1025961524 7:66226520-66226542 AAAACTAATGAGAATGTTTTTGG + Intronic
1027031012 7:74888896-74888918 AAACCTGACCATATTGTTTAGGG + Intergenic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1028840287 7:95422211-95422233 AAAGCTGCTCACACTGTTTTAGG + Intronic
1031279291 7:119776252-119776274 CAAACTAATCAGATTGCTTTTGG - Intergenic
1031659787 7:124408283-124408305 AAAGTTGATTATATTGTTTCAGG - Intergenic
1032473641 7:132197630-132197652 ACAGCAGATCAGATGGTTTAAGG - Intronic
1034395551 7:150821533-150821555 AAAGGTGACCAGATTGTGCTGGG - Intergenic
1037491987 8:19405199-19405221 AAAGATAAGCAGATTATTTTTGG + Exonic
1038069303 8:23995730-23995752 AAGGCTGATCAGATTGGCTCTGG + Intergenic
1038652830 8:29421200-29421222 AAAGCTGTACAGAGTGTATTTGG + Intergenic
1038988338 8:32837867-32837889 AAAGCTGATCCTCTTGTTTAAGG + Intergenic
1039144433 8:34430311-34430333 AAAGCTGATCTGATTGTGGCAGG - Intergenic
1039747897 8:40447602-40447624 AAAGCTGATCTCATTGTGTTTGG - Intergenic
1042880129 8:73478359-73478381 AAAGTTGATGAGTTTGTTTTGGG + Intronic
1044835459 8:96291245-96291267 AAAGCTGTTGAAATTGTCTTAGG - Intronic
1045833655 8:106494331-106494353 AAAGCTGATTATATTGTGTGTGG + Intronic
1046367296 8:113252087-113252109 AAAGATGAACAGATTTTTTAAGG - Intronic
1046760890 8:118019045-118019067 AAAACTGATCAGTGTGCTTTTGG + Intronic
1047969676 8:130073859-130073881 AAACCTGATCAGATAGATTGAGG - Intronic
1048057218 8:130878976-130878998 TAAGGTGATAATATTGTTTTTGG + Intronic
1051207360 9:14702326-14702348 AACTGTGATCAGATGGTTTTAGG - Intergenic
1053158357 9:35795686-35795708 AAAGGTGAGAAGATTGTTTTAGG - Intronic
1054905001 9:70407040-70407062 AGAGCATGTCAGATTGTTTTAGG + Intronic
1055143670 9:72906705-72906727 AAAGCTAAACAAATTGTTTATGG - Intronic
1059142207 9:111864254-111864276 AGAGCTGATCAGCTGCTTTTGGG - Intergenic
1059661339 9:116404883-116404905 AAACCTGATCACATGGTCTTAGG - Intergenic
1060231249 9:121827078-121827100 AAATGTGATCAGACTGTTATGGG - Intronic
1061380056 9:130250349-130250371 CAAGGTGGTCAGATTGTTTGAGG - Intergenic
1187443643 X:19342278-19342300 AAAGCTGGTCTGAATGGTTTGGG - Intergenic
1188046901 X:25435943-25435965 AAAGATTATCAGACTGATTTAGG - Intergenic
1188569340 X:31563361-31563383 GAAGCAGATCAGATTGTTTTTGG - Intronic
1189861650 X:45278247-45278269 TGAGATGATCATATTGTTTTTGG + Intergenic
1190835093 X:54093362-54093384 GAAGTTGAACAGATTGTTCTGGG + Intronic
1190935623 X:54996828-54996850 AAAGTGGATCAGATTTTGTTGGG - Intronic
1193333440 X:80260804-80260826 AATGCTGATGTAATTGTTTTGGG + Intergenic
1195250496 X:103040191-103040213 AAATGTGTTAAGATTGTTTTGGG + Intergenic
1196200535 X:112881493-112881515 AAAGATGATGAGTGTGTTTTTGG + Intergenic
1198911860 X:141624001-141624023 CAAGCTTCTCATATTGTTTTTGG - Intronic
1201603802 Y:15762973-15762995 AAAGCTCATCATATTGATTTGGG - Intergenic