ID: 1178370339

View in Genome Browser
Species Human (GRCh38)
Location 21:32021820-32021842
Sequence GCTCCTGGGCAGACACAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178370326_1178370339 19 Left 1178370326 21:32021778-32021800 CCGCTCTGGCACCCAGCCCGCCC 0: 1
1: 0
2: 4
3: 50
4: 430
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207
1178370330_1178370339 3 Left 1178370330 21:32021794-32021816 CCCGCCCCGTCTATGTGGTGCCA 0: 1
1: 0
2: 1
3: 8
4: 81
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207
1178370327_1178370339 8 Left 1178370327 21:32021789-32021811 CCCAGCCCGCCCCGTCTATGTGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207
1178370334_1178370339 -3 Left 1178370334 21:32021800-32021822 CCGTCTATGTGGTGCCAACAGCT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207
1178370331_1178370339 2 Left 1178370331 21:32021795-32021817 CCGCCCCGTCTATGTGGTGCCAA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207
1178370333_1178370339 -2 Left 1178370333 21:32021799-32021821 CCCGTCTATGTGGTGCCAACAGC 0: 1
1: 0
2: 0
3: 1
4: 80
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207
1178370332_1178370339 -1 Left 1178370332 21:32021798-32021820 CCCCGTCTATGTGGTGCCAACAG 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207
1178370329_1178370339 7 Left 1178370329 21:32021790-32021812 CCAGCCCGCCCCGTCTATGTGGT 0: 1
1: 0
2: 0
3: 8
4: 298
Right 1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG 0: 1
1: 0
2: 1
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178370339 Original CRISPR GCTCCTGGGCAGACACAACC GGG Intronic
900380568 1:2381944-2381966 CCTCCTGGGCTGACAGCACCAGG - Intronic
900548529 1:3241967-3241989 GCTCCTGGGCTGACCCTGCCTGG + Intronic
901187334 1:7383436-7383458 GTTACTGGGCAGACAGGACCAGG - Intronic
901533815 1:9869955-9869977 ACACCTGGGCAGACACACCCAGG + Intronic
901875063 1:12162712-12162734 GCTCTTGGCCAGACACTCCCTGG - Intergenic
903666345 1:25009818-25009840 GCTACTCAGAAGACACAACCAGG + Intergenic
904880329 1:33691672-33691694 GCTCATGGGGAGACACCATCAGG - Intronic
905664344 1:39753504-39753526 GCTCCTCTGCAGGCACAGCCTGG + Intronic
905874453 1:41423230-41423252 GCTCTGTGGCAGACAGAACCAGG + Intergenic
905880143 1:41457839-41457861 GCTCCTGGGCTCACCCAGCCTGG + Intergenic
907899147 1:58721477-58721499 GCTCCTGGTCAGAGGCAGCCTGG + Intergenic
907985312 1:59524362-59524384 GCTCCTGGGCAGAAAGGAGCGGG + Intronic
910711889 1:90190281-90190303 GCTCCTGTGTAGAAACATCCAGG - Intergenic
913960044 1:143332517-143332539 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914054399 1:144158090-144158112 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG + Intergenic
915837621 1:159190151-159190173 GGTTCTGGGAAGACACAATCAGG + Intronic
915931295 1:160062322-160062344 GCTCCGGGGCAGGCACAATGGGG - Intronic
918014288 1:180617929-180617951 GCTCCTGGGTGGTCACAAGCTGG + Intergenic
919016247 1:192041034-192041056 GCTCCTGGGCAGCTACCACATGG - Intergenic
920195567 1:204223907-204223929 ACTACTGTGCAGACAGAACCAGG + Intronic
920370096 1:205473321-205473343 TCTCCTCGGCAGATCCAACCAGG + Intergenic
921598222 1:217078350-217078372 GCTACTGTGTATACACAACCAGG - Intronic
922702324 1:227769142-227769164 GCCCCAGGGGAGACACAGCCTGG - Intronic
923092693 1:230752154-230752176 ACACCTGGGCACACACAACAAGG + Intronic
923459353 1:234195196-234195218 GCTCCTAGGTAGGCACAGCCTGG - Intronic
924724631 1:246657700-246657722 GCTCCTGCTCAGCCTCAACCAGG - Intronic
1067028450 10:42864569-42864591 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1069934506 10:71906040-71906062 GCCCCTGGGCAAGCACAGCCTGG + Intergenic
1070102128 10:73398270-73398292 GCTCCTGGGTAGCCACTACTTGG + Exonic
1070768849 10:79070756-79070778 GCTCCCGGGCAGGCGCAGCCGGG - Intronic
1071178554 10:82956103-82956125 GCTCCTGGGAAGGCAGACCCTGG - Intronic
1071280274 10:84095176-84095198 GCTCATGGGCACTCACAACCTGG + Intergenic
1075393953 10:122113436-122113458 GCTCCTGGGCAGACACTCTGGGG - Intronic
1075548370 10:123373339-123373361 CCACCTGGGCAGACCCAGCCAGG + Intergenic
1076085042 10:127620081-127620103 GATCCTGGGCAAAAACACCCTGG + Intergenic
1076782834 10:132733922-132733944 GCTCCTTAGCACACACATCCTGG + Intronic
1077235289 11:1479191-1479213 GCTCCTGGGCAGACGGGGCCTGG - Intronic
1078191432 11:9094744-9094766 TCTCCTGGGCGCACACAGCCTGG - Intronic
1078489348 11:11754937-11754959 GCGCCTGGCCAGAAACCACCAGG - Intergenic
1078576621 11:12508229-12508251 GCTGGAGGGCAGACACACCCTGG + Intronic
1083407077 11:62464949-62464971 GCTCCTGGACAGACACAGTCGGG + Intronic
1083686697 11:64380730-64380752 TCTCCAGGGCAGACGCAGCCTGG + Intergenic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1086249294 11:84794969-84794991 GCTCCTGGGCAGAAAGGAGCAGG + Intronic
1087066267 11:94030822-94030844 GCTCCTGGGTAGACACATGCAGG + Intronic
1088808545 11:113373562-113373584 ACTCATGGCCAGACACAACTTGG + Intronic
1089074291 11:115725778-115725800 GCTCTGGGGCAGACACAACAGGG + Intergenic
1089336960 11:117731857-117731879 GAACCTGGGCAGACACAGCTGGG + Intronic
1089525024 11:119091496-119091518 GCGCATGGGCTGGCACAACCGGG + Exonic
1089605509 11:119639015-119639037 GGTCCGGGGCAGACACACCTGGG - Intronic
1090917314 11:131176997-131177019 GGACCTGGGCAGACACCAGCAGG + Intergenic
1091676160 12:2491680-2491702 GCTGCTGGGAAGACACAATCGGG + Intronic
1091846833 12:3662717-3662739 GCTCCTGCTCACACACAGCCTGG - Intronic
1092230501 12:6773220-6773242 CCTCCTGGGCCCACACCACCGGG - Exonic
1099228888 12:80000475-80000497 GCTCTTGGGAAGACAGACCCAGG + Intergenic
1101744921 12:107532223-107532245 GCCCCAGGACAGACCCAACCAGG + Intronic
1103945399 12:124523352-124523374 GCTCCTGGGAACCCACACCCCGG + Intronic
1106271390 13:28157458-28157480 GCTTCTGGGCAGAGACGACGAGG - Intronic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1106704319 13:32264679-32264701 GCTCTAGGGCAGGCAGAACCAGG - Intronic
1106814490 13:33392206-33392228 GCACATGGGCAAACACAACAAGG - Intergenic
1107458073 13:40573393-40573415 GTTCCAGGGCAGACTCAACTTGG - Intronic
1107985199 13:45769816-45769838 GCTACTGTGCAGACACGGCCAGG + Intergenic
1109337526 13:61011096-61011118 GCTCAGGAGCTGACACAACCAGG - Intergenic
1109883949 13:68518075-68518097 GATTCTGGGCATACACAAGCAGG + Intergenic
1112284814 13:98094840-98094862 GCTGCTGAGCAGCCACCACCAGG - Intergenic
1116738596 14:48726676-48726698 GCTCCTGGGGAGAAATATCCAGG - Intergenic
1117166508 14:53039599-53039621 GATGCTGGGCAGACAAAAACAGG + Intronic
1117658751 14:57983062-57983084 GCACGTGGGCAGACAGAGCCAGG - Intergenic
1119085685 14:71736947-71736969 GGTGCTGGACAGACACAACGAGG - Intronic
1119543200 14:75453803-75453825 TTGCCTGGGCAGACAGAACCAGG - Intronic
1119856517 14:77905043-77905065 GCCCCTGGACAGACATAACATGG - Intronic
1121873442 14:97430143-97430165 TCTGATGGCCAGACACAACCAGG + Intergenic
1122113236 14:99515743-99515765 TCTCCTGGGCAGCCCCAGCCTGG + Intronic
1122786919 14:104168144-104168166 CCTCCTGGGCAGCCACACCTTGG + Intronic
1124606054 15:31171154-31171176 TCTGCTGGGCAGACACAGGCAGG - Intergenic
1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG + Intronic
1125444578 15:39739688-39739710 GCTCAGGGGTAAACACAACCAGG - Exonic
1126109488 15:45167226-45167248 GCTCTGGAGCAGACACAGCCCGG - Exonic
1126937920 15:53731745-53731767 CCTCCTGGGCAGCCAGCACCAGG + Intronic
1128361049 15:66962022-66962044 GCTCCTGGAGAGACAAAGCCGGG - Intergenic
1132575749 16:663021-663043 TCGCTTGTGCAGACACAACCGGG - Intronic
1132878990 16:2152985-2153007 GCTCATGGGCAGAGTCCACCTGG - Exonic
1135085580 16:19472258-19472280 GGTCCAGGGCAGAGAGAACCAGG + Intronic
1136031872 16:27509257-27509279 ACTCCTGGGCTGTCACAAGCTGG + Intronic
1136294382 16:29293326-29293348 GCTCCCGGGCAGACAATCCCTGG - Intergenic
1137850897 16:51741431-51741453 GACCCTGGGCAGACAAGACCAGG + Intergenic
1139147012 16:64337520-64337542 GCTGCTGGGCTTATACAACCAGG + Intergenic
1139433115 16:66921752-66921774 CCTCCAGGGCAGGCACACCCGGG + Exonic
1139625866 16:68187954-68187976 GCCCCTTGACAGAAACAACCTGG - Intronic
1142100288 16:88267373-88267395 GCTCCCGGGCAGACAATCCCTGG - Intergenic
1142690445 17:1603157-1603179 GCTCCTGGGCATAGCCAACGAGG + Intronic
1143108759 17:4542170-4542192 GCACCAGAGCAGACACTACCAGG + Intronic
1144575853 17:16428886-16428908 GCACCAGCGCAGACACAAGCAGG - Exonic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145265453 17:21377638-21377660 GCTCATGGGCAGAGACAGCTGGG + Intronic
1145976253 17:28986024-28986046 GTTCCTGGGCAGTCTCCACCAGG - Intronic
1146686065 17:34842324-34842346 TCTCCTGGGCATACCCAACAGGG + Intergenic
1147191828 17:38742382-38742404 GGTCCTGGCCAGACTCATCCTGG - Intronic
1150640733 17:66947904-66947926 GCTCCTGGGCAAGGACACCCAGG - Intergenic
1152170273 17:78741769-78741791 TCTCCTGGTCAAACCCAACCAGG + Intronic
1152305218 17:79516408-79516430 GCTCCTGGGCAGAGAGACACAGG + Intergenic
1152346190 17:79753412-79753434 CATCCTGGACAGACACACCCGGG - Intergenic
1152571125 17:81121721-81121743 GCTCCTGGGCAGAGGCTGCCTGG + Exonic
1160666051 19:329165-329187 GCTCCTGCCCAGACTCAACCTGG + Intronic
1160781389 19:879174-879196 GCTGCTGGGCATTGACAACCAGG - Intronic
1160781490 19:879566-879588 GCTGCTGGGCATTGACAACCAGG - Intronic
1160781530 19:879710-879732 GCTGCTGGGCATTGACAACCAGG - Intronic
1160781572 19:879854-879876 GCTGCTGGGCATTGACAACCAGG - Intronic
1160792226 19:928092-928114 GCTCCTGGGCAGACAAGGCCTGG - Intronic
1160905546 19:1450174-1450196 GCTCCGGGGCGGACAAAGCCCGG - Intronic
1163126202 19:15245554-15245576 TCTCAGGGGCAGACACACCCTGG - Intronic
1163205393 19:15798719-15798741 GCTGCTTGGCAGACAGAAACTGG - Intergenic
1163323122 19:16586170-16586192 GAGCCTGGGCAGGCCCAACCGGG + Intronic
1164987658 19:32660426-32660448 CCTCCTGGGCAGTCCCAAGCTGG - Intronic
1165068329 19:33241477-33241499 GCTCCTGGGCAGGCACTCCTGGG + Intergenic
1167215403 19:48161217-48161239 TGTCGGGGGCAGACACAACCTGG - Intronic
1202693878 1_KI270712v1_random:110768-110790 GCTCCTGGCAAGGCACAACCAGG - Intergenic
925134913 2:1520114-1520136 GCTCCAGGGCAGAAACATCCTGG + Intronic
925620295 2:5785657-5785679 GCTCCTGGACTGGCAAAACCTGG + Intergenic
925636180 2:5943033-5943055 GCTCCTGGGCAGCGTCATCCAGG - Intergenic
928238063 2:29562498-29562520 GGCCCTGGGCAGACACCATCTGG - Intronic
928435362 2:31251384-31251406 CCTCCAGGGAAGACACAGCCTGG + Intronic
931251168 2:60531694-60531716 GGCCCTGTGCAGACACCACCAGG + Intronic
931733961 2:65177557-65177579 GCTCCTGGGCAGAAAAAGGCAGG - Intergenic
932072049 2:68630309-68630331 GCTCCTGGGCTCAAACAACCAGG + Intronic
933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934521097 2:95020707-95020729 GCTCCTGGGCAGACCCAGAAAGG - Intergenic
937899065 2:127003205-127003227 GCATCTGAGCAGACACAGCCAGG - Intergenic
938746232 2:134280997-134281019 GCTACTTGGCAGTCACAGCCTGG + Intronic
943179476 2:184524767-184524789 GCCCCTCGGCAGAAACAGCCTGG - Intergenic
943771253 2:191720293-191720315 GCTACTGGACAGACAGAACGAGG + Intergenic
944658312 2:201898851-201898873 TCTCTTGGGCAGTCACATCCTGG - Intergenic
945330150 2:208529986-208530008 GCTCCTTGGCACAAACAGCCTGG - Intronic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
947316668 2:228866402-228866424 GCTCCTGGGCAGAAACAGGCAGG + Intronic
1171784051 20:29447509-29447531 GCTCCTTTGCAGGCTCAACCTGG + Intergenic
1172668038 20:36614227-36614249 ACCCCTGGGAAGCCACAACCCGG - Intronic
1172841672 20:37905719-37905741 GCTCCTCGGCAGTCACTACTTGG - Intronic
1175813514 20:61871920-61871942 ACTCCTAGTCAGACACACCCAGG + Intronic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1183045137 22:35213309-35213331 GCTCCTGGTCACAGACAGCCTGG - Intergenic
1184185962 22:42865699-42865721 GCTTCTGGGCAAAGACAGCCAGG - Intronic
950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG + Intronic
950688526 3:14636755-14636777 GCTCCTGGGCATTCACTCCCAGG + Intergenic
951080074 3:18443699-18443721 GCTCCCGGGCCGGCAGAACCGGG - Intronic
951781219 3:26364772-26364794 GCTGCTCAGCAGACACAACAGGG + Intergenic
952103584 3:30043419-30043441 GCTGCTGGGGAGACACAATTAGG + Intergenic
953802018 3:46031605-46031627 GCTCCTGGGCAGAAAGGGCCAGG + Intergenic
954912317 3:54121064-54121086 GCTCCTAGCCGGACACCACCTGG + Intergenic
961386460 3:126525746-126525768 GCTCCTTTGCAGACACTCCCCGG - Intronic
961685401 3:128626430-128626452 GGGCCTGGGCAGACAAAAGCAGG - Intronic
964431069 3:156606269-156606291 GCTTCTGGGCACACGCACCCCGG - Intergenic
965229272 3:166029528-166029550 GCCCCTGGGCAGGAACATCCTGG - Intergenic
967100284 3:186210423-186210445 CCACCTGGGGACACACAACCTGG + Intronic
968877519 4:3280805-3280827 TCCCCAGGGCAGACACTACCTGG + Intergenic
969636766 4:8373974-8373996 GCTCCTGGGCAGAGTGAAGCAGG + Intronic
976921503 4:90449519-90449541 ACTCCTCGGCAGAAACAGCCTGG - Intronic
977816257 4:101416922-101416944 GCTTCTGGGCAGATACAAGTGGG - Intronic
978386192 4:108177727-108177749 GCTTCTGGGCAGAGGCAACAAGG - Intergenic
980309854 4:131112809-131112831 GTGTCTGGGCAGACACAGCCAGG - Intergenic
981699553 4:147594246-147594268 GCTCCTGGGCAGAGAAATTCAGG - Intergenic
982198826 4:152939853-152939875 GCCCCTGGGCAGACAGAGACAGG - Intronic
982802625 4:159723146-159723168 GCTCCTGGGCAGAAAAAGACAGG - Intergenic
984526778 4:180867035-180867057 GCTCCTCGGCAGGGACAGCCTGG - Intergenic
984820363 4:183876396-183876418 CCTCCTGGTCAGAGCCAACCAGG - Intronic
987816016 5:22901801-22901823 GCTCCTGAGCAGAAACAGACAGG - Intergenic
989609451 5:43277298-43277320 GCTTCACGGCAGACACAATCTGG - Exonic
990406028 5:55491744-55491766 GCTACTGGGCAGACTGAAGCAGG + Intronic
995088297 5:108141167-108141189 CATCCTGGGCAGACAAAACCAGG - Intronic
995210233 5:109529637-109529659 CCTCTTGGGCAGGCACAACATGG - Intergenic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1002930820 6:1633799-1633821 GCTCCATGGCAGAAACCACCCGG - Intronic
1004246857 6:13986359-13986381 GCTTCTGAGCAGGCACAGCCAGG - Intergenic
1007623678 6:43229945-43229967 GCTCAAGGTCAGACAGAACCAGG + Intergenic
1010430015 6:75768078-75768100 GCTCCTGGGCAAATGCAAACTGG - Intronic
1011188732 6:84708056-84708078 GATCCTGGACAGAGACCACCTGG + Intronic
1011700716 6:89951742-89951764 GTTCCTGCGCATGCACAACCTGG - Exonic
1012263034 6:97110568-97110590 GCTCCTTGGCAAACACAAACTGG - Intronic
1012442414 6:99273205-99273227 GCTAATGGGCGGACACCACCTGG - Exonic
1015490368 6:133818044-133818066 GCTCCAAGACAGACACAAGCTGG - Intergenic
1015601635 6:134916329-134916351 TCTCCTGGGCAAAGACAAGCTGG + Intergenic
1017662746 6:156689904-156689926 GGACCTCGGCAGACACTACCAGG - Intergenic
1018617865 6:165704961-165704983 ACTCCTGGGAGGACACAACAGGG - Intronic
1019214991 6:170437815-170437837 GCCCCAGTGCAGACACAGCCAGG + Intergenic
1019415176 7:923766-923788 GCTCCTGCGAAGACGCCACCCGG + Intronic
1019731157 7:2630375-2630397 CCTCCTGGGAAGACACTGCCCGG + Intergenic
1021658022 7:22891040-22891062 GCCACAGGGCAGACACAGCCAGG + Intergenic
1023879459 7:44309924-44309946 GCGCCTGAGCAGCCAGAACCAGG + Intronic
1024149324 7:46553855-46553877 GCACCAGGTCAGACATAACCAGG - Intergenic
1024511386 7:50207446-50207468 GCCCCTGGGCAGAAACACCCTGG + Intergenic
1025020055 7:55473518-55473540 GCACCTGGGCACACATAGCCAGG + Intronic
1025637419 7:63335215-63335237 TCTCCTTGGCAGAAACACCCAGG - Intergenic
1025645278 7:63412884-63412906 TCTCCTTGGCAGAAACACCCAGG + Intergenic
1025715810 7:63954004-63954026 TCTCCTTGGCAGAAACACCCAGG + Intergenic
1026559724 7:71438455-71438477 ACACCTTGGCAGACACACCCAGG + Intronic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029285614 7:99463831-99463853 GCTCATGGCCAGACAAAAACAGG + Intronic
1029595888 7:101537524-101537546 TCTCCAGGTCAGACACAGCCAGG + Intronic
1029922770 7:104283273-104283295 GCTCCAGGGGAAACACAGCCTGG - Intergenic
1032079989 7:128853984-128854006 GCTCCTGGGCAGACACCATCTGG - Exonic
1032419177 7:131764303-131764325 GCTCCAGGGCTGACAGAAGCAGG - Intergenic
1032658350 7:133955633-133955655 GCTCCAGGGCAGACAGGGCCAGG - Intronic
1032919286 7:136527544-136527566 GCTCCTGGGCAGAAAGAAGTGGG - Intergenic
1034276599 7:149826551-149826573 CCTCCAGGGCAGCCACAGCCAGG - Intergenic
1036676746 8:10840091-10840113 GCTCCGCGGCAGACACGCCCAGG - Intergenic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1037877464 8:22554976-22554998 GCTCCTGAGCAGACCTACCCGGG - Exonic
1038338366 8:26663302-26663324 GCTCAAGGGCAGAACCAACCTGG + Intergenic
1039894164 8:41704609-41704631 GCTGCTGGGCAGAGACCACCAGG + Intronic
1040843713 8:51812019-51812041 GCTCCTTGGCAAAAACAACCTGG + Intergenic
1046027705 8:108745493-108745515 GCTCCTGGTCATACAGAAACAGG + Intronic
1046301243 8:112294027-112294049 TATCCAGGGCAGACACAAGCAGG + Intronic
1046942402 8:119943729-119943751 GCTCCTGGTCTGACAGAACGGGG - Intronic
1048986067 8:139735736-139735758 GCTCCTGGGCAGAGCCACGCTGG + Intronic
1049182140 8:141228375-141228397 GCCCCTGGCCAGACCCAAGCAGG + Exonic
1049812408 8:144581432-144581454 GCTCCTGAGCACCCGCAACCGGG + Intronic
1056196569 9:84234915-84234937 GCTGCTGGCCAGACACTGCCAGG - Intergenic
1056721035 9:89072239-89072261 GCTCAAGGTCAGACATAACCAGG - Intronic
1056886076 9:90445299-90445321 CCTTCTGGGCAGACACACTCTGG - Intergenic
1058270664 9:102968034-102968056 GCTCCTGGGCAGACAGGGGCAGG - Intergenic
1059469721 9:114495583-114495605 GATCCTGTGCAGAGACAACAAGG + Intronic
1061878472 9:133556685-133556707 ACACCTGGGCAGTCACAGCCAGG + Intronic
1190223522 X:48528573-48528595 GCTCATGGGCAGGCACAAGAAGG + Exonic
1192486614 X:71533071-71533093 GCTCCTCGGCCGAAACAACATGG - Exonic
1199400539 X:147394001-147394023 GCTTTTGGGCAGAGACCACCAGG - Intergenic
1199636236 X:149814734-149814756 GCTTCTGGGCAGAGACTATCGGG - Intergenic
1200091284 X:153637290-153637312 GCTCCTGGGCAGAGAGAAGGTGG - Intergenic
1201475452 Y:14376520-14376542 GTTTCTGGATAGACACAACCAGG + Intergenic