ID: 1178375034

View in Genome Browser
Species Human (GRCh38)
Location 21:32059609-32059631
Sequence ACACCTTCCACTACTCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178375034_1178375036 -4 Left 1178375034 21:32059609-32059631 CCAGCAGGAGTAGTGGAAGGTGT No data
Right 1178375036 21:32059628-32059650 GTGTGCAAAGAGCTGAAGGACGG No data
1178375034_1178375035 -8 Left 1178375034 21:32059609-32059631 CCAGCAGGAGTAGTGGAAGGTGT No data
Right 1178375035 21:32059624-32059646 GAAGGTGTGCAAAGAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178375034 Original CRISPR ACACCTTCCACTACTCCTGC TGG (reversed) Intergenic
No off target data available for this crispr