ID: 1178375036

View in Genome Browser
Species Human (GRCh38)
Location 21:32059628-32059650
Sequence GTGTGCAAAGAGCTGAAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178375034_1178375036 -4 Left 1178375034 21:32059609-32059631 CCAGCAGGAGTAGTGGAAGGTGT No data
Right 1178375036 21:32059628-32059650 GTGTGCAAAGAGCTGAAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178375036 Original CRISPR GTGTGCAAAGAGCTGAAGGA CGG Intergenic
No off target data available for this crispr