ID: 1178375036 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:32059628-32059650 |
Sequence | GTGTGCAAAGAGCTGAAGGA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1178375034_1178375036 | -4 | Left | 1178375034 | 21:32059609-32059631 | CCAGCAGGAGTAGTGGAAGGTGT | No data | ||
Right | 1178375036 | 21:32059628-32059650 | GTGTGCAAAGAGCTGAAGGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1178375036 | Original CRISPR | GTGTGCAAAGAGCTGAAGGA CGG | Intergenic | ||
No off target data available for this crispr |