ID: 1178376392

View in Genome Browser
Species Human (GRCh38)
Location 21:32071007-32071029
Sequence GAGGGCAGGTCAGCAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178376392_1178376394 -8 Left 1178376392 21:32071007-32071029 CCAGCACTTGCTGACCTGCCCTC No data
Right 1178376394 21:32071022-32071044 CTGCCCTCACCTCCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178376392 Original CRISPR GAGGGCAGGTCAGCAAGTGC TGG (reversed) Intergenic
No off target data available for this crispr