ID: 1178379729

View in Genome Browser
Species Human (GRCh38)
Location 21:32097728-32097750
Sequence TCTCACATGTGGGAGCAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178379729_1178379734 10 Left 1178379729 21:32097728-32097750 CCTAGTTGCTCCCACATGTGAGA No data
Right 1178379734 21:32097761-32097783 CTACAATTCAAGATGAGATTTGG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178379729 Original CRISPR TCTCACATGTGGGAGCAACT AGG (reversed) Intergenic
No off target data available for this crispr