ID: 1178381766

View in Genome Browser
Species Human (GRCh38)
Location 21:32115721-32115743
Sequence AAGTCTGAAGTCTCTAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178381766_1178381769 -7 Left 1178381766 21:32115721-32115743 CCTGCCCTAGAGACTTCAGACTT No data
Right 1178381769 21:32115737-32115759 CAGACTTGCCATCACCACAGTGG No data
1178381766_1178381771 1 Left 1178381766 21:32115721-32115743 CCTGCCCTAGAGACTTCAGACTT No data
Right 1178381771 21:32115745-32115767 CCATCACCACAGTGGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178381766 Original CRISPR AAGTCTGAAGTCTCTAGGGC AGG (reversed) Intergenic
No off target data available for this crispr