ID: 1178383869

View in Genome Browser
Species Human (GRCh38)
Location 21:32133991-32134013
Sequence GCTGAGGCCCAGTCTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178383869_1178383872 -1 Left 1178383869 21:32133991-32134013 CCACCTTCAGACTGGGCCTCAGC No data
Right 1178383872 21:32134013-32134035 CTCATGACCCATTCCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178383869 Original CRISPR GCTGAGGCCCAGTCTGAAGG TGG (reversed) Intergenic
No off target data available for this crispr