ID: 1178385029

View in Genome Browser
Species Human (GRCh38)
Location 21:32142110-32142132
Sequence GGTGGGGCTGAGAACCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178385029_1178385037 9 Left 1178385029 21:32142110-32142132 CCACAGAGGTTCTCAGCCCCACC No data
Right 1178385037 21:32142142-32142164 GGTCACAGTGAGCAAATTTAAGG No data
1178385029_1178385038 15 Left 1178385029 21:32142110-32142132 CCACAGAGGTTCTCAGCCCCACC No data
Right 1178385038 21:32142148-32142170 AGTGAGCAAATTTAAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178385029 Original CRISPR GGTGGGGCTGAGAACCTCTG TGG (reversed) Intergenic
No off target data available for this crispr