ID: 1178385763

View in Genome Browser
Species Human (GRCh38)
Location 21:32149015-32149037
Sequence ACATTGCCACTGAAGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178385759_1178385763 0 Left 1178385759 21:32148992-32149014 CCGCAAAGGAGAGCTGCAACACG No data
Right 1178385763 21:32149015-32149037 ACATTGCCACTGAAGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178385763 Original CRISPR ACATTGCCACTGAAGGACAG GGG Intergenic
No off target data available for this crispr