ID: 1178386391

View in Genome Browser
Species Human (GRCh38)
Location 21:32154145-32154167
Sequence TTACCGAGTGAGATGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178386388_1178386391 -2 Left 1178386388 21:32154124-32154146 CCTGATGCAATAGCCAATTGTTT No data
Right 1178386391 21:32154145-32154167 TTACCGAGTGAGATGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178386391 Original CRISPR TTACCGAGTGAGATGGAGTC AGG Intergenic
No off target data available for this crispr