ID: 1178386975

View in Genome Browser
Species Human (GRCh38)
Location 21:32160423-32160445
Sequence TAGTTTGCCAAGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178386971_1178386975 18 Left 1178386971 21:32160382-32160404 CCCCAAATATCTGAGACAGGTCA No data
Right 1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG No data
1178386973_1178386975 16 Left 1178386973 21:32160384-32160406 CCAAATATCTGAGACAGGTCACA No data
Right 1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG No data
1178386972_1178386975 17 Left 1178386972 21:32160383-32160405 CCCAAATATCTGAGACAGGTCAC No data
Right 1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178386975 Original CRISPR TAGTTTGCCAAGATTGAGGA TGG Intergenic
No off target data available for this crispr