ID: 1178387629

View in Genome Browser
Species Human (GRCh38)
Location 21:32166489-32166511
Sequence CTCAAAAAACAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178387625_1178387629 11 Left 1178387625 21:32166455-32166477 CCTGGAGTATTGTGTAGTATCAA No data
Right 1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178387629 Original CRISPR CTCAAAAAACAGAAGGATGG AGG Intergenic
No off target data available for this crispr